ID: 1155537661

View in Genome Browser
Species Human (GRCh38)
Location 18:26833560-26833582
Sequence CAGAGGCCTGCACTTGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155537651_1155537661 14 Left 1155537651 18:26833523-26833545 CCAAAGTGGGGTGGAGGCGCCGC No data
Right 1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG No data
1155537658_1155537661 -9 Left 1155537658 18:26833546-26833568 CCAGGTAGAGGGCACAGAGGCCT No data
Right 1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG No data
1155537655_1155537661 -5 Left 1155537655 18:26833542-26833564 CCGCCCAGGTAGAGGGCACAGAG No data
Right 1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG No data
1155537657_1155537661 -8 Left 1155537657 18:26833545-26833567 CCCAGGTAGAGGGCACAGAGGCC No data
Right 1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155537661 Original CRISPR CAGAGGCCTGCACTTGGGCG CGG Intergenic
No off target data available for this crispr