ID: 1155540752

View in Genome Browser
Species Human (GRCh38)
Location 18:26865556-26865578
Sequence CTTCTTAGGCAGAATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155540752_1155540756 18 Left 1155540752 18:26865556-26865578 CCTTCCAGATTCTGCCTAAGAAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1155540756 18:26865597-26865619 AAAGAGACAGTTTCATCTTTTGG 0: 1
1: 0
2: 3
3: 28
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155540752 Original CRISPR CTTCTTAGGCAGAATCTGGA AGG (reversed) Intronic
900406931 1:2496870-2496892 CTTCTGCTGCAGAATCTGGTGGG - Exonic
902336043 1:15755619-15755641 CTTCATAGCAAGAATCTGGTGGG - Intergenic
902436172 1:16399288-16399310 CTCTTAAGGAAGAATCTGGAAGG + Intronic
903174653 1:21573749-21573771 GTTCTTCCGCAGGATCTGGATGG - Exonic
903714373 1:25353180-25353202 CTTCTTATCCAGAGCCTGGAAGG + Intronic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905078793 1:35298433-35298455 CTTCTTAGCCAGATTCAGCAAGG - Intronic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
908511272 1:64851731-64851753 CCTGCTAGTCAGAATCTGGAAGG - Intronic
910434203 1:87188625-87188647 CTTGAAAGGAAGAATCTGGATGG - Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
911043194 1:93608004-93608026 CTTCTGAGTCAGAGGCTGGATGG + Intronic
915799160 1:158770285-158770307 TTGCTTAGGCAGAGTATGGAGGG - Intergenic
916678753 1:167085916-167085938 CTTCTGAGTCAGAATCCAGAGGG - Intronic
917173137 1:172200392-172200414 CTTCTTGGGTAGAATCTTGCAGG + Intronic
921116719 1:212098918-212098940 TTTCCTGGGCAGAATCTGCAGGG - Intronic
924316223 1:242800478-242800500 CTTCTTAGGAAGAACCAAGATGG - Intergenic
1064935504 10:20674536-20674558 CTTGTTAGGTAATATCTGGAAGG - Intergenic
1065770394 10:29072690-29072712 CTACTGAGACTGAATCTGGAAGG + Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067199795 10:44157118-44157140 CTTCTCAGGCAGTATCTATAGGG + Intergenic
1068002800 10:51356077-51356099 CTTATTAGGCAAAAGCTGCATGG + Intronic
1071312060 10:84352346-84352368 CTTCTGAGGCTCAATCTTGAAGG + Intronic
1073122371 10:101130645-101130667 CTTCTTAGACAAATTCAGGAAGG - Exonic
1073559182 10:104482197-104482219 CATCTTAGGCAGAATATATAGGG + Intergenic
1075663596 10:124215247-124215269 CTTCTTGGCCAGAATCATGATGG - Intergenic
1076015634 10:127025418-127025440 CTTCTTAGCCCCAACCTGGAAGG - Intronic
1078332657 11:10438525-10438547 CTGCTAAAGCAGAATCTAGAAGG - Intronic
1079596362 11:22253131-22253153 CTACTTAGGCACAATCTATAAGG + Intronic
1080040270 11:27752828-27752850 GTTCTTAGGCAGCAGCTGAAAGG - Intergenic
1080573403 11:33577303-33577325 CTTCTGAGGCAGTTGCTGGAGGG + Intronic
1080856625 11:36117184-36117206 GTTGTGAGGTAGAATCTGGAAGG + Intronic
1082038191 11:47663041-47663063 ATTCTTAGGCAGAATCAGGGTGG + Exonic
1083008341 11:59369768-59369790 CTTCTTGTGTAGAATCTTGAAGG - Intergenic
1083932251 11:65852453-65852475 TTTCTGATGCAGAAGCTGGAGGG + Exonic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1085119931 11:73960625-73960647 CTTCTGAGGAAGAAAATGGAGGG - Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1089522380 11:119073792-119073814 CTTCTTAAACAGCATCTAGAAGG - Exonic
1089587967 11:119522025-119522047 CTTCCTGGGCAGAATCTGTGGGG - Intergenic
1089887515 11:121842345-121842367 TCTCTTAGGCAGGATTTGGATGG - Intergenic
1090639975 11:128721908-128721930 CTTCTTAGGCAGGAAGAGGAGGG - Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1093792967 12:23276469-23276491 TTTCTTAGGAAGAATGTAGATGG + Intergenic
1098141715 12:67456764-67456786 CTCCTTATGCAAAGTCTGGATGG + Intergenic
1099148245 12:79075205-79075227 CTTCTTGGGCAAAATCTTCAAGG + Intronic
1099347607 12:81522688-81522710 CTTCTGAGGAAAAATTTGGACGG - Intronic
1099482575 12:83187623-83187645 CTTGTTAGGTAGAATTTGTAAGG - Intergenic
1100201011 12:92297825-92297847 CTTCTTAGGCATTATCTGCCTGG - Intergenic
1101542174 12:105675244-105675266 CTTCTTAGGAAGTTTCTGGAAGG - Intergenic
1101639452 12:106577312-106577334 CTTCTTAATCAGAATCTCGGGGG + Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1105089023 13:16252730-16252752 CTCTTTTGGCAGAATCTGCAAGG + Intergenic
1106169392 13:27275825-27275847 GTGCTTAGGGAGCATCTGGAAGG + Intergenic
1106451667 13:29887964-29887986 ATTCTTAGGCAGATTTTTGACGG - Intergenic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1107468322 13:40667961-40667983 TTTTTTAGGAAGAATATGGAAGG + Intergenic
1108444481 13:50493666-50493688 CTTCTTGGGCAGCATGTGCAAGG + Intronic
1109635520 13:65109828-65109850 CTTTTTAGACACAATCTTGAAGG - Intergenic
1109707427 13:66114683-66114705 CTGCTTAGGCAGTCTCTGTAAGG - Intergenic
1110449266 13:75623338-75623360 TTTCTAAGGCAGAATCAGAAAGG + Intronic
1110591948 13:77273535-77273557 CTTCTTGGGGAGAAACAGGAAGG - Exonic
1111093609 13:83479640-83479662 CTTCCTGGGCAGTATCTGCAGGG - Intergenic
1111427320 13:88103967-88103989 CTTCTCAGGCAGAAACTTAAGGG + Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112226968 13:97549250-97549272 CTGCTTAAGCAGCCTCTGGATGG - Intergenic
1118425871 14:65661146-65661168 TTTCTTAGGGAGGAGCTGGAAGG + Intronic
1119142423 14:72279457-72279479 CTTCTTATGGAGGATCTGGAAGG - Intronic
1121579654 14:95018443-95018465 CTTCTTAAGCACAATCTTAATGG + Intergenic
1122503749 14:102218779-102218801 CTCCCCAGGCAGAATCTGCACGG - Intronic
1126759175 15:51953669-51953691 CTTTTTACACAGAATTTGGAAGG + Intronic
1127291960 15:57579124-57579146 CTTATTAGGGAAGATCTGGAAGG - Intergenic
1128178504 15:65579285-65579307 CTTCTGAGGCAGCCTCAGGAAGG + Exonic
1128994490 15:72286722-72286744 CTTCAGAGGTAGAATCTGCAGGG - Intronic
1129334056 15:74842103-74842125 CTTCTCAGGCAGAATCCTGCGGG + Exonic
1132036218 15:98487048-98487070 CTTCTGAGGCAGAGTCAGCAGGG - Intronic
1132250867 15:100334681-100334703 CTTCTGAGGCACCACCTGGAGGG + Intronic
1137840385 16:51635977-51635999 GTTCTCTGGCAGAATTTGGAAGG + Intergenic
1139546314 16:67651449-67651471 CAGCTTGGGCAGAAGCTGGAGGG + Exonic
1144405214 17:14946100-14946122 TTTCTGAGGAAGAATCTTGATGG - Intergenic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1147930715 17:43978851-43978873 CTTCTGATGCAGAGTATGGAGGG - Intronic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1155862840 18:30925751-30925773 ATGCTTAGGCTGAGTCTGGAAGG + Intergenic
1157776306 18:50399341-50399363 CTCCATAGACAGGATCTGGATGG - Intergenic
1158194099 18:54865679-54865701 CTTCTTTTGAAGAATTTGGAGGG + Intronic
1164366339 19:27586577-27586599 CTTCTTTTGTAGAATCTGCAAGG + Intergenic
1164369315 19:27628907-27628929 CTTCTTATGTAGAATCTGCAAGG + Intergenic
1167475278 19:49697032-49697054 ATTCTGAGGCAGGACCTGGAAGG - Intronic
927657083 2:24958290-24958312 CTTCTTAGGAAGAATTAGGAAGG + Intronic
928187131 2:29121403-29121425 CTTCTAATGGAAAATCTGGAAGG - Exonic
930674723 2:54187990-54188012 CTTCTAAGGCAGCACCTTGAAGG - Intronic
931966870 2:67544632-67544654 CTTCTTAGGCTGAACCCAGAAGG - Intergenic
932883716 2:75528248-75528270 ATTCCTAGGCAGAATCTGAGGGG + Intronic
932930990 2:76038414-76038436 TTTATTAGGTAGAAACTGGATGG - Intergenic
933644503 2:84799425-84799447 CTACTTGGGCAGAGACTGGAGGG + Intronic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
936633974 2:114234576-114234598 TTTCCTGAGCAGAATCTGGAGGG - Intergenic
936684398 2:114811054-114811076 CTTCTAAGGCAGAACCAGCAGGG + Intronic
938753165 2:134354714-134354736 CTTCCTAAGCAGCTTCTGGAGGG + Intronic
943879402 2:193120581-193120603 CTACTTAGGCAGAAGATGAATGG + Intergenic
945011578 2:205469530-205469552 CTTCTGAAGCAGAGACTGGATGG - Intronic
946935888 2:224720404-224720426 TTTCTTAGGTAGAGTCTAGAAGG - Intergenic
1169233633 20:3911115-3911137 GTTATTAGGCAGCATCTGTAAGG + Intronic
1171281923 20:23908277-23908299 ATTCTTACGTAGAATCTTGAAGG + Intergenic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1174170939 20:48617918-48617940 CTAATTAGGCAGAATCAGTAGGG - Intergenic
1178041144 21:28642298-28642320 CTTCATGGGCAGGAACTGGAGGG + Intergenic
1182686523 22:32124356-32124378 CCACTTCTGCAGAATCTGGAGGG + Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
951297056 3:20950578-20950600 CTTCTTAGACAGAATCTTGCAGG + Intergenic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
956056020 3:65299894-65299916 TTCCTTAGGAAGATTCTGGAGGG - Intergenic
957710535 3:83852167-83852189 CTTCTTAGGTAGAATCTCAGTGG + Intergenic
962288909 3:134113772-134113794 CTCCTTAGGCAGCATATGGTTGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964331507 3:155608310-155608332 TTTCTTGAGCAGAATCTGGAGGG + Intronic
965486424 3:169284131-169284153 CTCCTTGGGCAGAGTCTTGATGG - Intronic
966201331 3:177361816-177361838 CTGCTTAGGCAGAAACTCTAGGG - Intergenic
966591042 3:181683267-181683289 CTTCTGAGGCAGAACAGGGAGGG - Intergenic
980008944 4:127574838-127574860 AGTGTTAGGCAGAATCTGGGGGG + Intergenic
982834254 4:160103750-160103772 GTTCTAAGGCAGATTATGGAGGG + Intergenic
983004700 4:162469303-162469325 ATTCTTAGGCAGTATCTAGTGGG + Intergenic
987199430 5:15560261-15560283 CTACTTAAGCAGAATCAGTAAGG - Intronic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
989832882 5:45942503-45942525 CTGCTTTGGTAGAATCTCGAAGG + Intergenic
993977347 5:94498604-94498626 CTTCTTATGCAGAAAAGGGAAGG - Intronic
994465686 5:100126897-100126919 CTTCATAAGCAGAATATGAAAGG + Intergenic
995433554 5:112109620-112109642 CTTCTCAGGAAAAATCTGTAAGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
999661326 5:153866264-153866286 CTACTGAGTCAGAATCTTGAGGG - Intergenic
1000087574 5:157901411-157901433 CTCCTGAAGCAGAAACTGGAGGG + Intergenic
1003706654 6:8539067-8539089 GTTCTTAGGCAGAAACTGTTTGG - Intergenic
1004149710 6:13104749-13104771 CTTCTTAGGGAGAATATTTAAGG - Intronic
1006843997 6:37050269-37050291 CTTCTTAGAAAGAAACTGAAAGG + Intergenic
1007450587 6:41938547-41938569 CTTCTAAGGAAGCATCTGGAAGG + Intronic
1008946384 6:57101502-57101524 CTTTTGAGGTAGAATCTAGAGGG - Intronic
1009876489 6:69511929-69511951 CATATAATGCAGAATCTGGATGG + Intergenic
1010879356 6:81149441-81149463 TTTCTTGAGCAGAATCTGGGGGG + Intergenic
1011111236 6:83838610-83838632 CTGCTGAGGCAGAAGCTAGAGGG - Intergenic
1013794664 6:113873485-113873507 CTTCTTTCCCAGAATCTGGGTGG - Intergenic
1014750136 6:125245939-125245961 TTTCTTAAGCAGAATCTGGGGGG - Intronic
1015488470 6:133798968-133798990 CTTCTTATGTAGAATCTTGCAGG + Intergenic
1016288793 6:142505376-142505398 CTTCTTGTGCAGAATCTTGCAGG + Intergenic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1018124858 6:160672002-160672024 CTTCTTGTGTAGAATCTGGCAGG - Intergenic
1019127237 6:169848932-169848954 CTTCTTGGGCAGAATGAGGCTGG + Intergenic
1020705794 7:11542564-11542586 CTGCTTAGAGACAATCTGGATGG + Intronic
1027468171 7:78540595-78540617 TTTCCTGGGCAGAATCTGGTGGG - Intronic
1027676469 7:81164505-81164527 TTTCTTAAGCACCATCTGGATGG + Intergenic
1031985639 7:128163101-128163123 ATTCTTAGGAAGAATTTGGGGGG + Intergenic
1032564519 7:132928123-132928145 CTTCCTAGTCAGAATGAGGAAGG + Intronic
1033678687 7:143570372-143570394 CTCCTTAGACAGAATCTTTAGGG - Intergenic
1033693151 7:143759078-143759100 CTCCTTAGACAGAATCTTTAGGG + Intergenic
1035136473 7:156708660-156708682 TTTCTTGAGCAGAATCTGGTAGG + Intronic
1036129345 8:6093997-6094019 TTGCTTAGGCAGAATCTGAGGGG - Intergenic
1041128109 8:54666224-54666246 CTACTTAGCCAGCATCTGGTTGG - Intergenic
1042896870 8:73680115-73680137 TTTCCTGGGCAGAATCTGGGTGG + Intronic
1044197647 8:89396687-89396709 ATTCTTAGGCAGATTCTTAATGG - Intergenic
1047479042 8:125263370-125263392 GTTCTTAGGAAGAAACTAGAAGG + Intronic
1049699428 8:144002480-144002502 CTTCTGAAGAAGATTCTGGATGG + Intronic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1050502276 9:6311404-6311426 CTTTTAAGGCATAATCTGTAAGG + Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1057371904 9:94480723-94480745 CTTTTTCTGCAGAATCTGAAGGG + Intergenic
1059492386 9:114679694-114679716 CTTCTTACACAGAGTCTGAAGGG + Intergenic
1060724438 9:125997735-125997757 CCTCTTGGGCAGAGTCTGGGAGG - Intergenic
1061387488 9:130299115-130299137 CTTCGTGGGCAGAGTCAGGAGGG - Intronic
1186739135 X:12498607-12498629 CTTCTGAGACAAACTCTGGAAGG - Intronic
1188105891 X:26146182-26146204 CTTCTTAGACAGACTCTGATGGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188901051 X:35733673-35733695 CATCTTAGGGAGAATATGGGTGG + Intergenic
1190971758 X:55356709-55356731 CCTCTTAGGCAGTCTCTAGAGGG - Intergenic
1192980797 X:76338872-76338894 GTTCTTTGCCAGAATATGGATGG + Intergenic
1193061348 X:77211386-77211408 CTTCTTGGGGAGAATCTTGCAGG + Intergenic
1193924033 X:87464002-87464024 GTTCCTTGGCAGAATCTGGGGGG + Intergenic
1194951001 X:100125790-100125812 CTTCATAGGCAGATACTGAAAGG + Intergenic
1197464927 X:126792087-126792109 CTTCATTGGCAGAAACTGTAGGG - Intergenic
1197759198 X:130015768-130015790 CATCTTAGGCAGGTTCTGGGGGG - Exonic
1198958327 X:142156542-142156564 CTTCTTAGGCAGTTTCTAGCCGG - Intergenic
1199035835 X:143050358-143050380 CTTCTTAGGCAGTTTCTTGCTGG + Intergenic
1199048398 X:143205497-143205519 CCTCTCTGGGAGAATCTGGAAGG - Intergenic
1199098480 X:143769293-143769315 CTTCTTGTGCAGAATCTTGCAGG - Intergenic
1199249179 X:145639558-145639580 CTTCTTGTGCAGAATCTTGATGG - Intergenic