ID: 1155542592

View in Genome Browser
Species Human (GRCh38)
Location 18:26884051-26884073
Sequence GTGGACACCCCCCGCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542592_1155542594 -8 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data
1155542592_1155542599 9 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542599 18:26884083-26884105 ATGTGGATCATAATACCCAGTGG No data
1155542592_1155542602 14 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542602 18:26884088-26884110 GATCATAATACCCAGTGGGGTGG No data
1155542592_1155542605 19 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542605 18:26884093-26884115 TAATACCCAGTGGGGTGGAGGGG No data
1155542592_1155542606 20 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542606 18:26884094-26884116 AATACCCAGTGGGGTGGAGGGGG No data
1155542592_1155542607 21 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542592_1155542603 17 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542603 18:26884091-26884113 CATAATACCCAGTGGGGTGGAGG No data
1155542592_1155542600 10 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542600 18:26884084-26884106 TGTGGATCATAATACCCAGTGGG No data
1155542592_1155542601 11 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542601 18:26884085-26884107 GTGGATCATAATACCCAGTGGGG No data
1155542592_1155542604 18 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542604 18:26884092-26884114 ATAATACCCAGTGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542592 Original CRISPR GTGGACACCCCCCGCCATAT GGG (reversed) Intergenic
No off target data available for this crispr