ID: 1155542594

View in Genome Browser
Species Human (GRCh38)
Location 18:26884066-26884088
Sequence GTGTCCACCACCCTGCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542584_1155542594 17 Left 1155542584 18:26884026-26884048 CCAGGGGAGGGGGGTGATATTAC No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data
1155542592_1155542594 -8 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data
1155542593_1155542594 -9 Left 1155542593 18:26884052-26884074 CCATATGGCGGGGGGTGTCCACC No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data
1155542582_1155542594 22 Left 1155542582 18:26884021-26884043 CCCAGCCAGGGGAGGGGGGTGAT No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data
1155542591_1155542594 -7 Left 1155542591 18:26884050-26884072 CCCCATATGGCGGGGGGTGTCCA No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data
1155542583_1155542594 21 Left 1155542583 18:26884022-26884044 CCAGCCAGGGGAGGGGGGTGATA No data
Right 1155542594 18:26884066-26884088 GTGTCCACCACCCTGCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542594 Original CRISPR GTGTCCACCACCCTGCTATG TGG Intergenic
No off target data available for this crispr