ID: 1155542596

View in Genome Browser
Species Human (GRCh38)
Location 18:26884073-26884095
Sequence TTATGATCCACATAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542596_1155542604 -4 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542604 18:26884092-26884114 ATAATACCCAGTGGGGTGGAGGG No data
1155542596_1155542603 -5 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542603 18:26884091-26884113 CATAATACCCAGTGGGGTGGAGG No data
1155542596_1155542611 22 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542611 18:26884118-26884140 TGATATTACTCCCCATATGGCGG No data
1155542596_1155542612 25 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542612 18:26884121-26884143 TATTACTCCCCATATGGCGGAGG No data
1155542596_1155542610 19 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data
1155542596_1155542606 -2 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542606 18:26884094-26884116 AATACCCAGTGGGGTGGAGGGGG No data
1155542596_1155542602 -8 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542602 18:26884088-26884110 GATCATAATACCCAGTGGGGTGG No data
1155542596_1155542607 -1 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542596_1155542613 26 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542613 18:26884122-26884144 ATTACTCCCCATATGGCGGAGGG No data
1155542596_1155542605 -3 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542605 18:26884093-26884115 TAATACCCAGTGGGGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542596 Original CRISPR TTATGATCCACATAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr