ID: 1155542597

View in Genome Browser
Species Human (GRCh38)
Location 18:26884076-26884098
Sequence GTATTATGATCCACATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542597_1155542606 -5 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542606 18:26884094-26884116 AATACCCAGTGGGGTGGAGGGGG No data
1155542597_1155542607 -4 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542597_1155542612 22 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542612 18:26884121-26884143 TATTACTCCCCATATGGCGGAGG No data
1155542597_1155542605 -6 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542605 18:26884093-26884115 TAATACCCAGTGGGGTGGAGGGG No data
1155542597_1155542604 -7 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542604 18:26884092-26884114 ATAATACCCAGTGGGGTGGAGGG No data
1155542597_1155542613 23 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542613 18:26884122-26884144 ATTACTCCCCATATGGCGGAGGG No data
1155542597_1155542611 19 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542611 18:26884118-26884140 TGATATTACTCCCCATATGGCGG No data
1155542597_1155542603 -8 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542603 18:26884091-26884113 CATAATACCCAGTGGGGTGGAGG No data
1155542597_1155542610 16 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542597 Original CRISPR GTATTATGATCCACATAGCA GGG (reversed) Intergenic