ID: 1155542607

View in Genome Browser
Species Human (GRCh38)
Location 18:26884095-26884117
Sequence ATACCCAGTGGGGTGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542593_1155542607 20 Left 1155542593 18:26884052-26884074 CCATATGGCGGGGGGTGTCCACC No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542592_1155542607 21 Left 1155542592 18:26884051-26884073 CCCATATGGCGGGGGGTGTCCAC No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542595_1155542607 2 Left 1155542595 18:26884070-26884092 CCACCACCCTGCTATGTGGATCA No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542598_1155542607 -5 Left 1155542598 18:26884077-26884099 CCTGCTATGTGGATCATAATACC No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542597_1155542607 -4 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542596_1155542607 -1 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data
1155542591_1155542607 22 Left 1155542591 18:26884050-26884072 CCCCATATGGCGGGGGGTGTCCA No data
Right 1155542607 18:26884095-26884117 ATACCCAGTGGGGTGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542607 Original CRISPR ATACCCAGTGGGGTGGAGGG GGG Intergenic
No off target data available for this crispr