ID: 1155542610

View in Genome Browser
Species Human (GRCh38)
Location 18:26884115-26884137
Sequence GGGTGATATTACTCCCCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542608_1155542610 -6 Left 1155542608 18:26884098-26884120 CCCAGTGGGGTGGAGGGGGGTGA No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data
1155542597_1155542610 16 Left 1155542597 18:26884076-26884098 CCCTGCTATGTGGATCATAATAC No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data
1155542596_1155542610 19 Left 1155542596 18:26884073-26884095 CCACCCTGCTATGTGGATCATAA No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data
1155542609_1155542610 -7 Left 1155542609 18:26884099-26884121 CCAGTGGGGTGGAGGGGGGTGAT No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data
1155542595_1155542610 22 Left 1155542595 18:26884070-26884092 CCACCACCCTGCTATGTGGATCA No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data
1155542598_1155542610 15 Left 1155542598 18:26884077-26884099 CCTGCTATGTGGATCATAATACC No data
Right 1155542610 18:26884115-26884137 GGGTGATATTACTCCCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542610 Original CRISPR GGGTGATATTACTCCCCATA TGG Intergenic
No off target data available for this crispr