ID: 1155542615

View in Genome Browser
Species Human (GRCh38)
Location 18:26884129-26884151
Sequence CTGGACACCCTCCGCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155542615_1155542626 21 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542626 18:26884173-26884195 ATAACCAGGAGGAGAGACGGGGG No data
1155542615_1155542625 20 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542625 18:26884172-26884194 AATAACCAGGAGGAGAGACGGGG No data
1155542615_1155542624 19 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542624 18:26884171-26884193 TAATAACCAGGAGGAGAGACGGG No data
1155542615_1155542623 18 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542623 18:26884170-26884192 GTAATAACCAGGAGGAGAGACGG No data
1155542615_1155542617 -8 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542617 18:26884144-26884166 GTGTCCAGCCTCCTGCGATGTGG No data
1155542615_1155542622 10 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542622 18:26884162-26884184 TGTGGATTGTAATAACCAGGAGG No data
1155542615_1155542621 7 Left 1155542615 18:26884129-26884151 CCCATATGGCGGAGGGTGTCCAG No data
Right 1155542621 18:26884159-26884181 CGATGTGGATTGTAATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155542615 Original CRISPR CTGGACACCCTCCGCCATAT GGG (reversed) Intergenic
No off target data available for this crispr