ID: 1155545181

View in Genome Browser
Species Human (GRCh38)
Location 18:26907321-26907343
Sequence CCACCAAATAAGGAGAAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155545176_1155545181 12 Left 1155545176 18:26907286-26907308 CCTAACTCAGAAGATGGAGTAGA 0: 1
1: 0
2: 0
3: 14
4: 431
Right 1155545181 18:26907321-26907343 CCACCAAATAAGGAGAAAGCAGG 0: 1
1: 0
2: 2
3: 27
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155545181 Original CRISPR CCACCAAATAAGGAGAAAGC AGG Exonic
900851660 1:5147984-5148006 CCACCAAACAAAGGCAAAGCAGG + Intergenic
901257465 1:7842650-7842672 CCTCCAAAAAAGAACAAAGCAGG - Exonic
901325297 1:8361682-8361704 CCACCAACTAGGGAGAACCCCGG + Intronic
902296305 1:15469397-15469419 CCCCTAAAGAAGGGGAAAGCTGG + Intronic
904335611 1:29795680-29795702 CCTCCATATAAAGAGAAATCTGG + Intergenic
905523580 1:38619267-38619289 CCACCAAATAAGTAGGAATTGGG + Intergenic
906716356 1:47972536-47972558 CCACCACATGAGGACAAAACTGG + Intronic
907446629 1:54512307-54512329 CAACCAAGTAAGGATATAGCAGG - Intergenic
907632283 1:56094845-56094867 CCAACAACCAAGGAGATAGCTGG + Intergenic
908005480 1:59723384-59723406 CCCTCAAATAATGAGAAATCTGG + Intronic
908109829 1:60885616-60885638 CCACCAAGGAAGGAGAGAGAAGG + Intronic
910001053 1:82342778-82342800 ACACCAATTAAGAAGAAACCAGG + Intergenic
910513900 1:88036882-88036904 CCACCCAGTAAGGAGAAGTCGGG - Intergenic
910681898 1:89875020-89875042 CCACTAAATAATGAGACAACAGG - Intronic
913242940 1:116845945-116845967 CCAACAACTAGGAAGAAAGCAGG - Intergenic
913378680 1:118185132-118185154 GCACCCAAGAAGGAGAAAGGAGG - Exonic
915441001 1:155945474-155945496 CCACCAAGAAAGGGGAATGCAGG - Intergenic
916395465 1:164382039-164382061 CCTCCAAATAAGGAGAGAAATGG + Intergenic
916741511 1:167650700-167650722 GCACCAATTAAGCACAAAGCAGG + Intronic
918288928 1:183087352-183087374 CCTCAAAATAAAGAGATAGCTGG + Intronic
920098514 1:203501898-203501920 CCTCCTAATATGGAGACAGCTGG - Intronic
921825797 1:219670677-219670699 TAACCAAATAAGAAGAGAGCTGG + Intergenic
1063010194 10:2014077-2014099 CCACCATATGAGGACACAGCAGG + Intergenic
1064738865 10:18411990-18412012 TCACCAACTAACCAGAAAGCTGG - Intronic
1064782684 10:18859650-18859672 CCACCCAAGAATGGGAAAGCTGG + Intergenic
1066586366 10:36941257-36941279 CCACAAAAAAAGGACAAAGGTGG + Intergenic
1068311130 10:55276995-55277017 CCTCCAAACAAAGTGAAAGCAGG - Intronic
1068812217 10:61269056-61269078 TCACCAAATGAGGAGATGGCAGG + Intergenic
1068968951 10:62943229-62943251 CCAGAAAACAGGGAGAAAGCAGG - Intergenic
1068996674 10:63213735-63213757 CCACCAAGTAAGGAGGCAGTAGG + Exonic
1071736105 10:88303004-88303026 GTACTAAAGAAGGAGAAAGCTGG + Intronic
1074170695 10:110932610-110932632 CAACCAAAAAAGGTGAAAGGGGG - Intronic
1074622404 10:115138819-115138841 CCATTTTATAAGGAGAAAGCTGG - Intronic
1075578549 10:123598534-123598556 CTTCCAAATAAGGACACAGCTGG - Intergenic
1075977538 10:126708641-126708663 CCACCAAACAAGGAGACAGGAGG - Intergenic
1077158494 11:1102093-1102115 CCACCCAATGAGGCAAAAGCAGG - Intergenic
1078451399 11:11443524-11443546 CCTACCAATAAGGAGAAAGAGGG + Intronic
1079032236 11:16994419-16994441 CCTCCAAACAAGGAGAAAGCAGG - Intronic
1080558376 11:33438339-33438361 GCACAAAATAAGGAGAAACGAGG - Intergenic
1082149960 11:48726328-48726350 TCACATAATAAGGAGAAAGAAGG + Intergenic
1082598907 11:55124069-55124091 TCACATAATAAGGAGAAAGAAGG + Intergenic
1082829182 11:57602791-57602813 AAAACAAAGAAGGAGAAAGCCGG + Intronic
1086002384 11:81998684-81998706 CAGCTAAATAAGGAGAAAGAGGG - Intergenic
1086215894 11:84380419-84380441 CCACAAAATAATGAGAAATCAGG + Intronic
1087310450 11:96535809-96535831 CATCCAAATAAGGAGAAAGAGGG + Intergenic
1089589415 11:119531026-119531048 CCACCAAACAAGGAGACAGAAGG - Intergenic
1089595836 11:119579504-119579526 CCACCAAACAAGGAGACAGGAGG - Intergenic
1092860345 12:12714815-12714837 ACAGCAAATAATGAGAACGCAGG - Intergenic
1092987752 12:13863041-13863063 CCGCCAAATAAGGAGGTAGGTGG - Intronic
1094153407 12:27311780-27311802 ACACCAAATAATGATCAAGCTGG + Intronic
1094194823 12:27737520-27737542 GCACCTATTAAAGAGAAAGCGGG - Exonic
1095379047 12:41567305-41567327 CCACCTAAAAAGAAAAAAGCAGG + Intronic
1095990389 12:48030300-48030322 CCACCACCAAGGGAGAAAGCAGG + Intergenic
1096349046 12:50878957-50878979 CCACCACGTAAGGATACAGCTGG + Intronic
1097180403 12:57168588-57168610 CCACCCAATGCTGAGAAAGCAGG + Intronic
1098019754 12:66141658-66141680 ACACAAATTAAGAAGAAAGCTGG + Intronic
1099878308 12:88436292-88436314 CCCCAAAATAATGAGAAATCTGG - Intergenic
1101144266 12:101826580-101826602 CCACCAAATAAGTACAGGGCAGG - Intronic
1102319322 12:111917801-111917823 AAAACAAATAAGAAGAAAGCAGG - Intergenic
1102434283 12:112908652-112908674 CCAGGAAATTAGGAGACAGCTGG + Exonic
1102659495 12:114513641-114513663 CCAGCAAATAAGGTGGGAGCTGG - Intergenic
1109075442 13:57828801-57828823 CCCACAATTAAGGGGAAAGCGGG - Intergenic
1111728258 13:92040430-92040452 CCACCAGAAAAGCAGTAAGCCGG + Intronic
1113920229 13:113903736-113903758 ACCCCAAATAATGAGGAAGCTGG + Intergenic
1118337822 14:64869145-64869167 CCACCAAGTAAGGTAATAGCTGG - Intronic
1123471682 15:20559613-20559635 CCACCAAACAAAAAGAAAACGGG - Intergenic
1123646323 15:22440740-22440762 CCACCAAACAAAAAGAAAACGGG + Intergenic
1123731985 15:23154598-23154620 CCACCAAACAAAAAGAAAACGGG - Intergenic
1123750121 15:23351980-23352002 CCACCAAACAAAAAGAAAACGGG - Intergenic
1124172327 15:27387604-27387626 CCACCTAAAAAGGAGGAATCTGG - Intronic
1124282489 15:28375898-28375920 CCACCAAACAAAAAGAAAACGGG - Intergenic
1124300214 15:28535707-28535729 CCACCAAACAAAAAGAAAACGGG + Intergenic
1125137746 15:36363746-36363768 ACACCAAAGAGGTAGAAAGCTGG - Intergenic
1125313558 15:38406899-38406921 CCATAAGATAAGGAGAAAGTTGG + Intergenic
1127243964 15:57150979-57151001 CCTCCAAAAAAGGAGAAAAAAGG - Intronic
1129903497 15:79169764-79169786 ACACCAAATTAGCAGAAAGAAGG - Intergenic
1130160588 15:81395228-81395250 CCACCAAATTTGTAGCAAGCTGG + Intergenic
1132776515 16:1598032-1598054 TCACCAAAGAAGTAGAAATCTGG + Intronic
1133273953 16:4625443-4625465 CCACTAAAGAAAGCGAAAGCCGG - Intronic
1133636043 16:7666608-7666630 CCCACAAATAAGGAAAAAGAAGG + Intronic
1134514230 16:14873890-14873912 TCAAGAAACAAGGAGAAAGCGGG - Intronic
1134701870 16:16272388-16272410 TCAAGAAACAAGGAGAAAGCGGG - Intronic
1134969961 16:18522262-18522284 TCAAGAAACAAGGAGAAAGCGGG + Intronic
1135507964 16:23055449-23055471 CCACCATATGAGGACACAGCTGG + Intergenic
1135542049 16:23337678-23337700 GCACTAAATAAGAAGAAACCTGG - Intronic
1135671827 16:24382114-24382136 CCACCAAATGAGGAGATGGGAGG - Intergenic
1137691953 16:50434613-50434635 CCACCAAATGAGGAGATGGGAGG - Intergenic
1137741647 16:50782366-50782388 CCACCAAAAATGGAAAAAGAAGG + Exonic
1138161462 16:54758779-54758801 CCAACAACTAATGAGAAATCAGG - Intergenic
1140721452 16:77775906-77775928 CCACCATGTAAGGACACAGCTGG + Intergenic
1144054400 17:11526117-11526139 ACACCAAATCAGCAGAGAGCGGG - Intronic
1144112451 17:12049326-12049348 CCACACAATAAAGAGAAACCTGG - Intronic
1148353518 17:46958273-46958295 ACACCAAATAAGGAGAAATATGG + Intronic
1151360060 17:73583486-73583508 CCACCAAATAAAGAGAAAGGAGG + Intronic
1153227132 18:2907522-2907544 CCACAAAATGAGGAGAGTGCAGG + Intronic
1155545181 18:26907321-26907343 CCACCAAATAAGGAGAAAGCAGG + Exonic
1156727075 18:40141375-40141397 CCACATAATAAGTAGAATGCTGG - Intergenic
1158032208 18:52979572-52979594 CTCCCAAGTAAGGAGAAAGTAGG + Intronic
1160210253 18:76871915-76871937 CCAGCAAACTATGAGAAAGCTGG - Intronic
1162727669 19:12699897-12699919 TCCCCAAAGAAGTAGAAAGCAGG + Exonic
1163624981 19:18384041-18384063 CCACCCAATGAGGAGATAGGAGG + Intronic
1164058041 19:21639292-21639314 CCCCCAAATAATGGAAAAGCAGG - Intergenic
1164249204 19:23462195-23462217 CCTCCAGATCAGGAGTAAGCAGG - Intergenic
1165486941 19:36101934-36101956 CCACCTGAAATGGAGAAAGCGGG - Intronic
1165803719 19:38567849-38567871 CCTCCAAAGAAGGAGGAAGCTGG + Exonic
1165852906 19:38860871-38860893 ACAACAAAAAAGAAGAAAGCAGG - Intergenic
1168150015 19:54441156-54441178 TCACCAAATATGCAAAAAGCAGG + Intergenic
926477065 2:13336831-13336853 CTACTAAATCAGGAGGAAGCAGG - Intergenic
927361992 2:22246729-22246751 ACAACAAAAAAGCAGAAAGCAGG + Intergenic
929698159 2:44138010-44138032 CCACCAAACAAGGAGATAGGAGG + Intergenic
930469860 2:51798792-51798814 TCAACAGATAAGGAGAAAGTGGG - Intergenic
931945819 2:67306144-67306166 TCACCACATGAGGATAAAGCAGG - Intergenic
932856655 2:75241243-75241265 CCACCAGATCAGGAGAGAACAGG + Intergenic
933469868 2:82708275-82708297 CTACCAAATAAAAAGAAGGCAGG + Intergenic
937182200 2:120006819-120006841 CCACCAAATCACGTGAAAGTAGG + Intergenic
937757333 2:125556332-125556354 CCACCAAAAAAAGAGACAGAAGG + Intergenic
938208349 2:129442733-129442755 CCACCAAGCAAGGAGAAGGGAGG - Intergenic
939535716 2:143425210-143425232 CCACCTAATAAGGAGACATCTGG - Intronic
943157113 2:184196872-184196894 CCTCCATATATGGAGAAAGAGGG - Intergenic
943467064 2:188240921-188240943 CCACCAAATGAGGAGACAGGAGG + Intergenic
943991197 2:194694906-194694928 TCACAAAATAATGAGAAAGTTGG + Intergenic
944183244 2:196919402-196919424 CCATCAAATAACAAGAAAGCAGG + Intronic
945035440 2:205700264-205700286 CCAAAATAAAAGGAGAAAGCAGG - Intronic
1169104832 20:2985873-2985895 CAAACAAACAAGGAGACAGCTGG - Intronic
1169441296 20:5636060-5636082 CCACAGAATAAAGTGAAAGCAGG - Intergenic
1171304639 20:24094744-24094766 CAACCAAATGAGGAGACAGAAGG + Intergenic
1172241091 20:33412863-33412885 CCACCAAACCAGGAGAAACCAGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1175407190 20:58742883-58742905 CTACTAATTAAGGGGAAAGCTGG - Intergenic
1178194196 21:30324050-30324072 ACACCAAATTAGCAGAAAGAAGG - Intergenic
1178366275 21:31991567-31991589 CCATCACATAAGAAGAAACCTGG - Intronic
1179987381 21:44929237-44929259 CCACCAGGTAGGGACAAAGCAGG - Intronic
1184028195 22:41873904-41873926 CCCCCAAAGAAGGAGAAAGGCGG + Exonic
1184682607 22:46080175-46080197 CCACCAAAAAAGGAGGAGGCTGG - Intronic
1184910838 22:47532972-47532994 CCATCAAATTAAGAGAAAGTAGG + Intergenic
949358137 3:3203126-3203148 CCACCAAACAAGGAGACAGGAGG - Intergenic
949408127 3:3735744-3735766 CTACCAAAAAAAGAAAAAGCCGG + Intronic
950113477 3:10435302-10435324 GTCCCAAATAAGGAGGAAGCAGG + Intronic
950932108 3:16800318-16800340 CCAAGAAAGAAGGTGAAAGCAGG + Intergenic
952540248 3:34359849-34359871 CCACCAAATGAGGAGATGGGGGG + Intergenic
953589382 3:44236868-44236890 CCACTGAATAAGGAGAAAGGAGG - Intergenic
957255054 3:77825811-77825833 CCACCAGAACAGGAGAAAGCAGG - Intergenic
957732838 3:84163486-84163508 CCACCAATTAAGAAGAAAATTGG - Intergenic
959262237 3:104097653-104097675 GCACAAAACAAGAAGAAAGCTGG + Intergenic
961279221 3:125752660-125752682 CCCTCTAATCAGGAGAAAGCTGG - Intergenic
963765992 3:149336452-149336474 CCAGCAAGTAGGAAGAAAGCTGG + Intergenic
965288235 3:166844066-166844088 CCACCAATTCTGGACAAAGCGGG + Intergenic
965794803 3:172428628-172428650 CCACCAAATGAGGACAAAGTGGG - Intergenic
966749771 3:183310789-183310811 CAAGGAGATAAGGAGAAAGCTGG + Intronic
967932233 3:194698460-194698482 CCAGCAGAAAAGGACAAAGCGGG + Intergenic
968344669 3:197991567-197991589 TCACCCAATCAGGAGAAGGCCGG - Intronic
968713231 4:2136016-2136038 CCAACAAATTAGGAGTATGCTGG - Intronic
969442936 4:7227913-7227935 GCCCCAGAGAAGGAGAAAGCAGG - Intronic
971482068 4:27123873-27123895 TCACCAAACAAGGAGACAGCAGG - Intergenic
973073062 4:45889276-45889298 CCATCAAAAAAAGACAAAGCAGG - Intergenic
973637257 4:52871526-52871548 CCAACAAATAAGGAAAAAGAGGG - Intergenic
973910622 4:55576510-55576532 CTAACAAATAAGGAGAAGGATGG + Intronic
974496043 4:62629055-62629077 TCATCAAACAAGGAGAAACCTGG + Intergenic
974813405 4:66974965-66974987 CAACCACAGAAAGAGAAAGCTGG + Intergenic
975118117 4:70701951-70701973 CTAACAAGAAAGGAGAAAGCTGG + Intergenic
975781781 4:77847995-77848017 CCACCAAATAAAGAAACAGGAGG - Intergenic
975982184 4:80173621-80173643 CCACCAAATGATGAGAGACCTGG + Intergenic
977410173 4:96653030-96653052 CCGCCAACTCAGAAGAAAGCGGG - Intergenic
977796266 4:101168590-101168612 CCACAAACTAAGGAAAAAGCAGG + Intronic
978990983 4:115081807-115081829 TCACCATATAAGGGGAAAGTGGG - Intronic
979868207 4:125782232-125782254 ACATCAAATATAGAGAAAGCAGG + Intergenic
980396937 4:132226720-132226742 TCTCAAAATAAGGAGAAAGCAGG - Intergenic
981775240 4:148359667-148359689 CCATAAAATATGGAGAAAGTGGG - Intronic
982810826 4:159824093-159824115 GCACCCAATAAGGAGATAACAGG - Intergenic
983063581 4:163185384-163185406 TCACCAACTCAGGAAAAAGCTGG - Intergenic
983719049 4:170823211-170823233 CCAGCATTTAAGAAGAAAGCAGG - Intergenic
984373153 4:178892352-178892374 CCTCCAGATAAGGACATAGCAGG + Intergenic
984496677 4:180506703-180506725 CAACCCAATAAGCAGAGAGCTGG - Intergenic
984905130 4:184619370-184619392 CCACCAAACAAGAAGACAGGAGG - Intergenic
986824728 5:11507928-11507950 CCAGCAAATAAGGACAAATAAGG + Intronic
992722978 5:79578796-79578818 CCAACAAATCAGGAGAAGGAAGG - Intergenic
995335519 5:110994685-110994707 CCACAAAAAAAGGAGAATGAAGG + Intergenic
996242318 5:121219316-121219338 CCAAGAACTAAGGATAAAGCAGG + Intergenic
996849212 5:127933836-127933858 CCACCATATAAGGACACAGCTGG + Intergenic
998616692 5:143748457-143748479 TCAAGAAAAAAGGAGAAAGCTGG + Intergenic
1000005634 5:157181529-157181551 CCACTAAAAAATAAGAAAGCTGG - Intronic
1003149254 6:3534909-3534931 CCAGGAAATGAGGAGAAAGTAGG - Intergenic
1004142217 6:13028792-13028814 CCACTGAATAAGGAGCAAGGTGG + Intronic
1007486263 6:42182886-42182908 CCATCAAAAAAAGAGAAAGAAGG - Intergenic
1007926930 6:45657238-45657260 CCACCAAAAATGGAGGAAGAAGG + Intronic
1008796029 6:55304126-55304148 ACAACAAGGAAGGAGAAAGCTGG + Intergenic
1008931114 6:56941059-56941081 ACACAAAATAAGTAGAAAGAAGG - Intronic
1009199934 6:60732321-60732343 CTACCAAGTAAGGAGACAGATGG - Intergenic
1011257794 6:85441765-85441787 CAGCCAAATAAGGAGACAGGAGG + Intergenic
1011361189 6:86526767-86526789 CCACCAGATTGGGAGAAAGGAGG - Intergenic
1011520552 6:88199762-88199784 CTACCAAACAAGAACAAAGCAGG - Intergenic
1012207858 6:96483264-96483286 CCACCAAAAAAGGAAAGAGATGG + Intergenic
1013251766 6:108341529-108341551 CCAACAGATAAGGAGACAGCAGG + Intronic
1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG + Intergenic
1017230562 6:152069142-152069164 CAGCCAAATAAGGAGACAGAAGG + Intronic
1018761643 6:166898944-166898966 GCACAAAGTAAGGAGAAAGTTGG + Intronic
1018879702 6:167864847-167864869 CCACCAAAAGAGAAGAAAGATGG - Intronic
1021450616 7:20780375-20780397 GAGCCAAAAAAGGAGAAAGCAGG + Intergenic
1025028914 7:55539944-55539966 CTCCCAAATAAGGAAACAGCAGG + Intronic
1026090639 7:67297782-67297804 ATACCCAGTAAGGAGAAAGCGGG + Intergenic
1027114279 7:75466279-75466301 CCACAAAACAAGCAGAAAGAAGG + Intronic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1028796696 7:94910591-94910613 TCCCCAAAGAAAGAGAAAGCTGG + Exonic
1030004920 7:105108395-105108417 CAACCAAATAATGGGAAATCAGG - Intronic
1030185412 7:106757058-106757080 GCACCAAATGAGGACAGAGCAGG + Intergenic
1031114992 7:117657997-117658019 CCAGGAAATAAGGAAAAAGGAGG - Intronic
1031253459 7:119417269-119417291 CAACCCAATATGAAGAAAGCAGG + Intergenic
1031275895 7:119723352-119723374 CCACCACATAAGGACACAGCAGG - Intergenic
1031937971 7:127755370-127755392 CCAGCAAAGAGGGAGAAAGAAGG - Intronic
1034898041 7:154890166-154890188 CCACCAAAGGAGCAGAAGGCAGG - Intronic
1035292591 7:157849220-157849242 CCACCGAAGAGGCAGAAAGCTGG + Intronic
1035402406 7:158576108-158576130 ACCCCAAATAAGCAGCAAGCAGG + Intronic
1038259428 8:25980138-25980160 CCACCAAAAAACGGAAAAGCGGG + Intronic
1038706945 8:29903114-29903136 CCACCAAATGAGGATATGGCAGG + Intergenic
1039174139 8:34784157-34784179 TCATCAAAGAAGTAGAAAGCTGG + Intergenic
1039891316 8:41687599-41687621 CCACCAAACAAGGAGGGAGGAGG - Intronic
1039914977 8:41852967-41852989 CCACCACATATGGACAAAGAAGG - Intronic
1039937652 8:42060845-42060867 CCACATAATAAGTAGAAAGGAGG + Intergenic
1040435462 8:47386845-47386867 CCAGAAAATAAGGAGGAAGTGGG + Intronic
1043033307 8:75166820-75166842 CCACCAAATAAGGACACAGAGGG + Intergenic
1044556144 8:93564049-93564071 TCACCCAATAATGAGAAAGGAGG - Intergenic
1044587259 8:93879361-93879383 CCACCAAATGAGGAGATGGGAGG + Intronic
1046822109 8:118645174-118645196 TCAGCAAATGAGGAGCAAGCGGG + Intergenic
1048519101 8:135137493-135137515 CCACCATTTAAGGACATAGCAGG - Intergenic
1056304206 9:85273241-85273263 CCAGCAAGAAATGAGAAAGCTGG + Intergenic
1057513078 9:95697135-95697157 CAACGAAATAACGTGAAAGCAGG - Intergenic
1059818610 9:117946847-117946869 CCTCCAACTAAGAATAAAGCTGG - Intergenic
1060706959 9:125811743-125811765 CCACCATGTAAGGATACAGCAGG - Intronic
1061099093 9:128478632-128478654 AAACCAAAAAAGGAGAAAACTGG - Intronic
1186562718 X:10630214-10630236 TCAACAAATAAGTAGAAAGTAGG + Intronic
1187917747 X:24171209-24171231 CCACAAAAAAAAGAGAAAGCTGG - Intronic
1188067166 X:25677183-25677205 CATCCAAATAAGTAGAAAACTGG - Intergenic
1188067766 X:25682528-25682550 CAAAGAAATAAGGAGAAAGAGGG - Intergenic
1188414215 X:29912869-29912891 CCACCAAATAAGGGCAAATAAGG - Intronic
1189067273 X:37823806-37823828 CCACTATAAAAGGAAAAAGCTGG + Intronic
1193634762 X:83935317-83935339 ATACCAAATAAAGAGAATGCTGG + Intergenic
1194589151 X:95775327-95775349 GTACCAAATGAGGAGATAGCAGG + Intergenic
1195701076 X:107706283-107706305 CCACCACCTAAGGAAAAAACAGG - Intergenic
1196403210 X:115337516-115337538 GCAGGAAATTAGGAGAAAGCAGG + Intergenic
1198844026 X:140890094-140890116 GCAACAAATAAGGAGAACACTGG - Intergenic
1199326501 X:146504410-146504432 CCTTAAAATAAGGAGAAAGGGGG + Intergenic
1199410844 X:147520707-147520729 CCACAAAATAAGCAGAAGACAGG + Intergenic
1200791847 Y:7306078-7306100 CCAACGAAAAAGAAGAAAGCAGG - Intergenic