ID: 1155545906

View in Genome Browser
Species Human (GRCh38)
Location 18:26914648-26914670
Sequence TAGGAGACACAGATGGGACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155545900_1155545906 0 Left 1155545900 18:26914625-26914647 CCCATTGCAGTTTACTTACTCCT 0: 1
1: 0
2: 1
3: 10
4: 156
Right 1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG 0: 1
1: 0
2: 2
3: 28
4: 336
1155545901_1155545906 -1 Left 1155545901 18:26914626-26914648 CCATTGCAGTTTACTTACTCCTT 0: 1
1: 0
2: 2
3: 19
4: 244
Right 1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG 0: 1
1: 0
2: 2
3: 28
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155545906 Original CRISPR TAGGAGACACAGATGGGACA CGG Exonic
901295427 1:8157402-8157424 TTGGAGACGCAGTTGGTACATGG + Intergenic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904260480 1:29284886-29284908 TAGAAGCCACTGGTGGGACAGGG - Intronic
904345721 1:29867593-29867615 TCTGAGACACAGATGGGACAAGG + Intergenic
904893300 1:33795283-33795305 TAGGAAACCCAGAAGGGCCAAGG - Intronic
905084597 1:35360863-35360885 TAGGATAGACAGAGGGGACTTGG + Intronic
905350389 1:37341985-37342007 TAGGAGAAACTGATGGGAAGGGG + Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905856243 1:41316674-41316696 AGGGAGTCACTGATGGGACAGGG - Intergenic
907713603 1:56907298-56907320 TGGGAGACACAGAGGATACAGGG + Intronic
907944264 1:59119615-59119637 TGGGAGACAGAGATGGGGGATGG - Intergenic
907961990 1:59292672-59292694 TAGTAGACAGAGAGGAGACACGG - Intergenic
908335414 1:63118138-63118160 TTGGAGACACAGATGTGAAGGGG + Intergenic
909721957 1:78782705-78782727 TAGGAGACAAAGATACAACACGG + Intergenic
909823940 1:80101567-80101589 CAGGAGACAAAGGTGGGACTAGG - Intergenic
910463823 1:87475328-87475350 TAAGTGAGACAGAAGGGACAGGG - Intergenic
910549190 1:88456593-88456615 GAGGAGACAAAGATGGGAAGAGG - Intergenic
911277939 1:95886249-95886271 GAGGAGAGACAGATGGGATAAGG - Intergenic
912230132 1:107783569-107783591 TAGAAGACACAGAGAGAACAAGG - Intronic
912310607 1:108617314-108617336 TAGGAGTAACAGAGAGGACAGGG + Intronic
912760740 1:112365137-112365159 TAGGAAAGACAGATGGCAAAGGG + Intergenic
913147443 1:116006289-116006311 TAGGAGATACAGTGGGGACCAGG - Intronic
914872969 1:151490686-151490708 TAGGAGAAACTGGTCGGACACGG - Intergenic
915141655 1:153771952-153771974 CAAGAGACAGAGGTGGGACACGG + Exonic
916077900 1:161213326-161213348 TAGGAGACAGAGTTTGGATATGG + Intronic
916755437 1:167765216-167765238 TAGGAGAAACAGGTTGGCCATGG + Intronic
917981511 1:180272345-180272367 AAGGGGACAAAGATGGGAGAGGG - Intronic
918206323 1:182312629-182312651 TGTGAAACACAGATGGGACCAGG - Intergenic
920541716 1:206783786-206783808 AAGGTCACACAGATGGGAAAGGG - Intergenic
921369377 1:214405909-214405931 TAAGAGGCACAGCTGGGATAGGG + Intronic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
924090068 1:240492743-240492765 TAGGGGGCACAGGTGGGACCCGG + Exonic
924094113 1:240533555-240533577 GAGGAGGCACAACTGGGACAAGG + Intronic
924608361 1:245554080-245554102 TAGGGGACAGGGGTGGGACATGG - Intronic
1062907073 10:1186443-1186465 CAGGAGGCACCAATGGGACAAGG - Intronic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063131526 10:3181996-3182018 TTTGAGACACAGAGGGGAAAAGG + Intergenic
1064114219 10:12563884-12563906 TAGATGACAGAGATGGCACAAGG - Intronic
1064568112 10:16664006-16664028 CAGGAGTCACAGAAGGGACTAGG + Intronic
1067285528 10:44905009-44905031 TGGGAGCCACAGATGAGAGATGG + Intergenic
1067287075 10:44914520-44914542 AAGCAGACACAGCTGGGAAATGG + Intronic
1068023679 10:51616732-51616754 TAGGATACACAGGTGAGAAATGG + Intronic
1068714017 10:60167696-60167718 TATGAGACACTAATGGTACAAGG + Intronic
1068991658 10:63157183-63157205 TGGGAGACAGACATGGGGCAGGG - Intergenic
1070606967 10:77905526-77905548 TAGTTGACACAGCAGGGACAAGG - Intronic
1071391063 10:85175803-85175825 GAGGAGAGACAGAGGAGACAGGG + Intergenic
1071988529 10:91076518-91076540 TTGGAGGCACACATGAGACAGGG + Intergenic
1072409331 10:95185102-95185124 TAGGTGACACAAAGGGGACCTGG + Intergenic
1072741826 10:97914425-97914447 AAGGAGGCGCACATGGGACATGG - Intronic
1072972408 10:100028690-100028712 TAGGAGGCAAAGCTGGGGCAGGG - Intergenic
1073248784 10:102109190-102109212 ACGGAGACTCAGATGGGAGAGGG + Intronic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1076835266 10:133017762-133017784 TAGTAGACACGGATGCCACATGG + Intergenic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077848091 11:6046881-6046903 TAGGAGATATAGATGAGAAATGG + Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078646608 11:13146724-13146746 TGAGAGACAGAGATGAGACATGG - Intergenic
1079145171 11:17844767-17844789 TAGAAGACAGACATGGGCCAGGG + Intronic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1081800978 11:45859152-45859174 TATGAGGCACAGGTGGGACTCGG - Intronic
1082634957 11:55584075-55584097 TAGGAGCCCCAGAGGGGTCAGGG - Intergenic
1083820989 11:65171331-65171353 TAGGAGATGGAGATGGGGCAGGG - Exonic
1083995882 11:66272061-66272083 TCGGAGACCCAGCTGGGGCAGGG + Intronic
1084551550 11:69846179-69846201 GAGAAGACACAGAGGGGAGAAGG + Intergenic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1086841865 11:91695733-91695755 TAGGAGACAGATATGAGAAATGG + Intergenic
1087207726 11:95414951-95414973 TATGAGAGACAGATGAGAGAGGG + Intergenic
1087511797 11:99103792-99103814 AAAGAGACACATAGGGGACAAGG + Intronic
1087954716 11:104271383-104271405 TAGGAGACACAGGTGGTAACTGG - Intergenic
1090030577 11:123202737-123202759 TGGCAGAAACAGGTGGGACAGGG + Intergenic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091096050 11:132823192-132823214 TAGGAGAAAAAAATGGAACAGGG - Intronic
1091218283 11:133916812-133916834 GAGGAGTCACAGCTGGGACAGGG + Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091821214 12:3476560-3476582 TAAGAGAGAGAGATGGGAGAGGG - Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093775225 12:23065770-23065792 TAGGAGAACAATATGGGACAGGG + Intergenic
1095796241 12:46221930-46221952 CAGAAGACAGAGATGAGACAGGG + Intronic
1096743664 12:53712123-53712145 TAAGAGAGACAGAGGGGAAAGGG + Intronic
1096876988 12:54637091-54637113 TGGGAGACACAGGTGGGAGATGG + Intergenic
1100795663 12:98179291-98179313 TGGGAGACAAGGATAGGACATGG - Intergenic
1101570161 12:105946453-105946475 GAGGAGAAAAAGATGGGAAAGGG - Intergenic
1101614863 12:106326326-106326348 AAGGAGACTCAGGTGGGCCATGG + Intronic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1103439818 12:120954855-120954877 TATGAGACAAAAATGGGATAAGG + Intergenic
1106352087 13:28940792-28940814 CATGAGAGACACATGGGACATGG + Intronic
1106643743 13:31611345-31611367 GAGGAGGAACAGATGGGTCAAGG + Intergenic
1108588516 13:51892119-51892141 CAGGAGACTCAGATGAGGCAGGG - Intergenic
1109106892 13:58264317-58264339 CAGGAGGCATAGATGGGACTGGG - Intergenic
1109837749 13:67880871-67880893 TGGGAGACACGGATGTTACATGG - Intergenic
1110055103 13:70958014-70958036 AAGAAGACACAGACGGGGCAAGG + Intergenic
1114362841 14:21994435-21994457 TAGGGGACAGAGATTGGGCATGG + Intergenic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1115475201 14:33806682-33806704 TAGGAGACACAGAAAGCAGAAGG - Intergenic
1117010790 14:51468285-51468307 GGGGAGACAGAGATGGGAGAGGG + Intergenic
1120647056 14:87086810-87086832 GAGGAGACACAGATGTCATAGGG + Intergenic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1121263303 14:92582100-92582122 TAGGAGGCACAGATGGGCCTAGG + Intronic
1121674909 14:95744614-95744636 TAGGAGACAGGGAAAGGACAGGG + Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1123112022 14:105876525-105876547 TGGAAGACACAAATAGGACATGG - Intergenic
1124422859 15:29537797-29537819 TGGGAAACAATGATGGGACAGGG - Intronic
1125277375 15:38007633-38007655 TAAGAGACACAAATGAGACAGGG + Intergenic
1125504533 15:40259267-40259289 TTGGAGACATGGATGGGAAAAGG + Intronic
1125524513 15:40366732-40366754 TAGCAGCCACAGATAGAACAGGG - Intronic
1126902339 15:53327143-53327165 GAGGAGACAAATGTGGGACATGG + Intergenic
1127705618 15:61544735-61544757 TAGGAGACACAAACAGGACAAGG - Intergenic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1129293245 15:74584634-74584656 TTGGAGACAAAGATGAGAGATGG - Intronic
1129868925 15:78928763-78928785 TCAGCGACACAGATGGGCCAAGG + Intronic
1130199844 15:81814773-81814795 TAGGTGAAAGAGATGGGTCAGGG + Intergenic
1130886445 15:88096477-88096499 CAGGAGACTCAGGTGGGCCAGGG - Intronic
1131142049 15:89984863-89984885 TAGGAAACACAGCTGGGCCAGGG - Intergenic
1132268838 15:100504681-100504703 TCGGGGACACAGAAAGGACAGGG + Intronic
1134247687 16:12552231-12552253 TAGGAGGCAAAGCTGGGGCATGG - Intronic
1135284421 16:21181123-21181145 TGGGATATGCAGATGGGACAGGG + Intergenic
1136013017 16:27376857-27376879 TAGGAGACATACAGGAGACAAGG - Intergenic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1137701691 16:50502346-50502368 TAGGAGGCACCGCTGGGAGATGG + Intergenic
1138456804 16:57125768-57125790 TAGGAGAGGTAGATGGGACATGG - Intronic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139310796 16:66026452-66026474 TGGGAGACAGAGCAGGGACAAGG + Intergenic
1139332525 16:66204555-66204577 AAGGTGACACAGTAGGGACACGG + Intergenic
1140028179 16:71311164-71311186 TTGAAGACACACTTGGGACAAGG - Intergenic
1140351563 16:74266718-74266740 TAGAAGACACAGAATGGAGAAGG - Intergenic
1141985117 16:87574967-87574989 TTGGATGCACAGATGGGAGATGG - Intergenic
1142291483 16:89195389-89195411 TAGGAGGCAAAGGTGGGACTAGG - Exonic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1143323402 17:6082438-6082460 TGGGAGACATGGAAGGGACACGG + Intronic
1143695402 17:8611745-8611767 TGTGAGACCCAGATGGGACGAGG + Intronic
1144262125 17:13531967-13531989 TAGGAAAGAGAGAGGGGACAGGG + Intronic
1144947526 17:18977573-18977595 AAGGAGGCACAGGTGGGTCAGGG - Exonic
1146454298 17:32997126-32997148 GAGGAGAGGGAGATGGGACAAGG + Intronic
1147793916 17:43029384-43029406 TAGGAGTCAGAGTTGGGAGAAGG + Intergenic
1148158710 17:45437748-45437770 AAGGGGACACAGCTGTGACACGG + Exonic
1150390126 17:64785146-64785168 AAGGGGACACAGCTGTGACACGG + Intergenic
1151765227 17:76130276-76130298 TAGGAGACTCAGCTTGGAAAAGG + Intergenic
1152043424 17:77920007-77920029 AAACAGACACAGATGTGACATGG + Intergenic
1153807690 18:8723682-8723704 TAGGAGACAGAGAAGGTGCAGGG - Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155610593 18:27663035-27663057 TAGGAGTTTCAGAAGGGACAGGG - Intergenic
1156651358 18:39230190-39230212 GAGGCGTCAGAGATGGGACATGG + Intergenic
1157347328 18:46851520-46851542 TTGGAGTCAAAGATGGGAGATGG + Intronic
1158316858 18:56220851-56220873 TAGGAGACACATAAGCGAGAAGG + Intergenic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1158551225 18:58437970-58437992 TAGGAGTCACACAGGAGACAAGG - Intergenic
1160357646 18:78241880-78241902 AAGGACACACAGATGGGAGTGGG + Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160902251 19:1434391-1434413 TTGGAGACACACATGGCCCAAGG - Intronic
1161640012 19:5416400-5416422 GAGGAGATACAGATGGCAAATGG - Intergenic
1162184734 19:8895903-8895925 TAGGTGACATAGGTGGGACTAGG + Intronic
1165702493 19:37949168-37949190 GAAGAGACAGAGATGGGAGATGG - Intronic
1165785742 19:38460636-38460658 TAGGAGTCAGAGAGGGGGCAGGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167810724 19:51827926-51827948 TAGGAGAGACAGAAGGGAAAAGG - Intergenic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
926564026 2:14450293-14450315 TAGGAGAAACAGATGTCACCAGG - Intergenic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
926965187 2:18402054-18402076 TAGAAGAGACAGATGGGAAGGGG - Intergenic
927029588 2:19106583-19106605 TAACAGACACAGATGGGTAATGG - Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927683405 2:25154811-25154833 TGAGAGACACAGCAGGGACATGG - Exonic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930271472 2:49262649-49262671 TAAGAGACAAAGAGGAGACAGGG + Intergenic
930279053 2:49348323-49348345 TATTAGACATTGATGGGACAGGG + Intergenic
931248891 2:60513293-60513315 TATGAGACAAGGAGGGGACAAGG + Intronic
932065301 2:68551495-68551517 TAGAAGAAACATGTGGGACATGG - Intronic
932221965 2:70006486-70006508 TAGGAGACCAAGAGGGTACAGGG + Intergenic
932224756 2:70030749-70030771 TATAAGATACAGAGGGGACAGGG + Intergenic
932757730 2:74420460-74420482 TAGGAAACAGATATGAGACAAGG - Intronic
932839900 2:75072414-75072436 TTGGAGACCCAGATGTGAGAGGG + Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
933966724 2:87435983-87436005 AAGGGGACACAGAAGTGACAAGG - Intergenic
935863324 2:107358282-107358304 TAGGAAACACAGAGGGGATGAGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937235887 2:120431798-120431820 TTGGACACAGAGACGGGACAAGG - Intergenic
938553006 2:132398017-132398039 AAGCAGACACAGATGAGACATGG - Intergenic
938732699 2:134158703-134158725 GGGGAGGCACAGGTGGGACAGGG - Intronic
941714014 2:168745066-168745088 TATGAGACACAGGTGGGAAGTGG + Intronic
941870941 2:170385086-170385108 TAGAAGAGACACATGGGGCAGGG + Intronic
942210264 2:173663153-173663175 CAGGAGATAAAAATGGGACAGGG - Intergenic
944264561 2:197709262-197709284 TAGGGGAACCAGATAGGACAGGG + Intronic
944438458 2:199716877-199716899 AAAGAGACATAGATGGGAAATGG + Intergenic
945595161 2:211781968-211781990 TGGGAGACATATATGAGACATGG - Intronic
946139857 2:217681208-217681230 TAGGAGAAACAGCTAGCACAGGG + Intronic
948687316 2:239677414-239677436 GAGGAGACGCAGCAGGGACAAGG - Intergenic
1170003999 20:11646487-11646509 GAGGAGGCACAGCTGGGTCAAGG + Intergenic
1170469640 20:16655628-16655650 GAGGAGCAACAGATGGGATATGG + Intergenic
1172436522 20:34932479-34932501 TAGGAGTCAGGGATGGTACAAGG - Intronic
1172993199 20:39050761-39050783 CAGGAGAAGCAGATGGGCCATGG + Intergenic
1174485197 20:50856582-50856604 TACCAGACACAAAAGGGACAAGG - Intronic
1175277444 20:57781908-57781930 TGGGGGACACAGATGAGAAAGGG + Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175626063 20:60489162-60489184 GAGTGGACACAGATGTGACATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179656370 21:42847625-42847647 AAGCAGACACAGATAAGACATGG + Intronic
1181164468 22:20976001-20976023 TAGGAGATACTGGTGGGACTTGG + Intronic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182572994 22:31252873-31252895 TGGGTGACACAGATGGTAAATGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1182985543 22:34712879-34712901 TAGGAGCCTCAGAGGGGACCTGG + Intergenic
1183058338 22:35320384-35320406 TGGGAATCACAGAGGGGACAGGG + Intronic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183994247 22:41621030-41621052 GAGGTGACAGAGAGGGGACAGGG + Exonic
950118645 3:10467500-10467522 TGGCAGACACAGTTGGCACATGG + Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950668984 3:14513936-14513958 GAGGATACACAGGTGGGCCAGGG - Intronic
952310987 3:32190163-32190185 TAGGAGATAAAGATATGACAAGG + Intergenic
953528291 3:43713783-43713805 TAGGAGACAGTGATGGGCAAGGG + Intronic
953667897 3:44939181-44939203 AAGGAGACACAAAAGGGACATGG + Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
954827123 3:53383895-53383917 TAGGAGGCACAGCTGAGCCATGG - Intergenic
955707927 3:61747736-61747758 TTGAAGACAAAGATGGGACCAGG - Intronic
955791747 3:62595220-62595242 TAGTAGAGACAGAGAGGACATGG + Intronic
956903049 3:73736646-73736668 TAGGAGGCACACCTGGGAAAGGG + Intergenic
958832638 3:99108194-99108216 AAGGAGACACAGGGGGAACAAGG - Intergenic
958867827 3:99521800-99521822 TGGGAGAAATAGATGAGACAAGG - Intergenic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
960302501 3:116021005-116021027 TAGGAGACACTGATGGTACTTGG + Intronic
960485796 3:118251450-118251472 TTGGAGCCACAGATGGGACTGGG - Intergenic
960901409 3:122557976-122557998 TAGGAGACTCAGATTAGAAATGG - Intronic
961295959 3:125884536-125884558 TAGGAGACAGAGATCAGCCAGGG - Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
962896801 3:139722836-139722858 TAGGAGACACTGATGTGAAAAGG + Intergenic
964608389 3:158583592-158583614 TGAGAGACAGAGATGGGAAATGG + Intronic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967472965 3:189884332-189884354 TAGGAGACCAAGATGGAAGAGGG - Intronic
967788216 3:193520163-193520185 AAGGAGACAAAGGTGGGAAAGGG + Intronic
969235180 4:5860502-5860524 AAGGAGACACAGCTGGGAAGTGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
971319453 4:25593650-25593672 TAGGAGAGACAGATGAGTGAAGG + Intergenic
971849340 4:31963079-31963101 TAGAAGACAAAGGTGGGAGAAGG - Intergenic
972997676 4:44902254-44902276 TAGAAAACAAGGATGGGACAGGG - Intergenic
974061125 4:57037163-57037185 CAGGAGTCACTGATGGGTCATGG + Intronic
974400845 4:61403817-61403839 TAGGACACACAGCTGGTACCTGG + Intronic
974974843 4:68878238-68878260 TAGGAGACAAATCTGTGACAAGG + Intergenic
975525618 4:75346421-75346443 TAGGATAAAAGGATGGGACAAGG + Intergenic
976915904 4:90374588-90374610 TACCTGACACATATGGGACAGGG - Intronic
977841389 4:101710554-101710576 TAGGAGACAAATAAGGGAGAGGG - Intronic
978109966 4:104951580-104951602 TAGGAGACAAAAATGGGACAAGG + Intergenic
979668843 4:123341499-123341521 TAGAAGGAACAGATGGGACATGG + Intergenic
980319438 4:131250215-131250237 TAGGAGAGAGAGAGGGGAAAAGG - Intergenic
981156119 4:141438353-141438375 TAGAAGACACAGAGGGAAGAAGG - Intergenic
983393095 4:167159453-167159475 TAGAAGACACAGAGAGGACCTGG + Intronic
984340533 4:178451064-178451086 AAGGAGAAACATATGGGAAAGGG - Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
985709504 5:1420276-1420298 GAGGAGACTCAGCTGGGCCATGG - Intronic
985875234 5:2589561-2589583 TAGGAGACACAGGTGAGGGAGGG + Intergenic
986165370 5:5267961-5267983 TAGGAGACACGGATGAACCATGG + Intronic
988261536 5:28892551-28892573 ATGGAGACACAGACGGGAAAGGG + Intergenic
989235558 5:39144347-39144369 TAGGAAATACAGAGGAGACAGGG + Intronic
989301203 5:39896079-39896101 GAGGAGACACTAAGGGGACATGG + Intergenic
990501632 5:56402189-56402211 TAGGAACCACAGAGGGGAAAGGG - Intergenic
991042223 5:62188087-62188109 TTGGAGCCACAGAGGAGACATGG + Intergenic
992266131 5:75020058-75020080 TAGGAGACTCATAAGGTACATGG + Intergenic
994294801 5:98078087-98078109 GAGGAGACACAGAAGAGCCATGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994331358 5:98510148-98510170 GAGGAGACAGAGATGAGACGAGG + Intergenic
994656590 5:102601693-102601715 TAGGAAACACAGATGTCAAAAGG + Intergenic
995333160 5:110968233-110968255 TAGGAGAAACAAATAGGAAATGG + Intergenic
995907970 5:117149401-117149423 AAGGAGGCACAGAAAGGACAAGG - Intergenic
996540059 5:124621442-124621464 TGGGAGTCACTGATGGGACCAGG - Intergenic
996684936 5:126269687-126269709 TGGGAGGAACAGATGGGAGAAGG - Intergenic
997795069 5:136800901-136800923 TGGGAGTGACATATGGGACATGG - Intergenic
998214260 5:140225493-140225515 GAAGAGAAACATATGGGACATGG - Intronic
998448872 5:142219180-142219202 TACAAGACGCAGATGGGAAAGGG - Intergenic
998630152 5:143889040-143889062 TAGAAGGGAAAGATGGGACATGG - Intergenic
1000598243 5:163241105-163241127 TAGGAAACATAAATGGGGCAAGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001151017 5:169227103-169227125 TGGAAGACACAGAGGAGACAGGG + Intronic
1001447473 5:171796995-171797017 TAGGACACACAGACAGGAAAGGG - Intergenic
1002616191 5:180458013-180458035 TAGGACACACAGGAAGGACAGGG + Intergenic
1002874394 6:1198893-1198915 TAGGAGTCACAGTTAGGAGAAGG - Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1005670280 6:28098914-28098936 CAGGAGATACAGCTGGGCCAGGG - Intergenic
1005717963 6:28569599-28569621 GAGGAGTCAAAGATGGGTCAAGG - Intergenic
1007391086 6:41549708-41549730 TAGGAGAGACAGATATCACATGG + Intronic
1007836575 6:44678591-44678613 GAGGAGACAGAGAGGGGATAAGG - Intergenic
1009490107 6:64279528-64279550 TAGGAAAGACAGCAGGGACATGG + Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1010152387 6:72748967-72748989 TATGAGAAACAGATGTGCCATGG + Intronic
1011545777 6:88480080-88480102 TAGGGGACAGGCATGGGACATGG - Intergenic
1011594140 6:88999942-88999964 CAGGAGATACAGCTGGGTCAGGG - Intergenic
1011869663 6:91876925-91876947 AAGGAGAGAAAGATGGGAAAAGG - Intergenic
1012734421 6:102920817-102920839 TAGGACCCACAGATTGGACCAGG - Intergenic
1013036269 6:106386894-106386916 GAGGAGACAGAGTTGAGACAGGG + Intergenic
1015958654 6:138624301-138624323 TAGGTGACACTGATGTGTCATGG + Intronic
1017441829 6:154471746-154471768 TAAGAGACACAAACGTGACAGGG - Intronic
1017766062 6:157608378-157608400 TAGGAGGCACCGGTGGTACAGGG + Intronic
1018300072 6:162392377-162392399 TAGTAGACAGAGATTGGAGATGG - Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019024561 6:168948341-168948363 TAGGAGACACAGTCAGGAGAGGG - Intergenic
1019572812 7:1720921-1720943 TAAGGGACACAGCTGGGACCTGG - Intronic
1020360029 7:7318278-7318300 ATGGAGACACAGATAGGATAAGG + Intergenic
1020361230 7:7328884-7328906 TAGGAGACAAAGAAGAGACATGG + Intergenic
1020533349 7:9362695-9362717 TAGGAGACTGAGATGGGAGGAGG + Intergenic
1021601981 7:22373230-22373252 TAGGAGACAGAGGTGAGGCAGGG + Intergenic
1022044622 7:26612967-26612989 TGGGAGCCAAAGCTGGGACAAGG + Intergenic
1022528643 7:31053477-31053499 TAGGGGGCTCAGAAGGGACAGGG + Intronic
1022739569 7:33108734-33108756 TGGGAGACAAAGAAGGGCCAGGG - Intronic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1025138761 7:56444491-56444513 TAGGAGAAACAGCTGAGACTGGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026738009 7:72961037-72961059 AAGCAGACACAGGTGGCACAGGG + Intronic
1026789046 7:73319832-73319854 AAGCAGACACAGGTGGCACAGGG + Intronic
1027105725 7:75404031-75404053 AAGCAGACACAGGTGGCACAGGG - Intronic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1028539292 7:91924712-91924734 TAAGAGAAACAGAAGAGACAAGG + Intergenic
1029918589 7:104238015-104238037 TAGGGGACATAGATGAGCCAAGG + Intergenic
1030217791 7:107063774-107063796 TGGGAGAAACAAATGGGAAAAGG - Intronic
1031504029 7:122558979-122559001 TAAGAGACATATATGGGAGAAGG - Intronic
1033595098 7:142853957-142853979 CAGGAGAGCAAGATGGGACAGGG + Intergenic
1035128806 7:156631623-156631645 TAGGAGACAAAGCTGGGCCAAGG - Intergenic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1039878987 8:41611713-41611735 GAGGAGAGAAAGAGGGGACAGGG - Intronic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1040704732 8:50111764-50111786 TATGAGTGACAAATGGGACATGG + Intronic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1042324709 8:67516591-67516613 TAGAAGACACAGATGTGAACAGG - Intronic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1044082508 8:87903271-87903293 TAGGAAAAAATGATGGGACATGG - Intergenic
1045978982 8:108161813-108161835 TAGGAGACAGAGATGCCACAAGG - Intergenic
1046179835 8:110630245-110630267 TAGAAGACACAGAAGAGATAGGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1051500214 9:17768558-17768580 TAGGAGAGACAGAAAGCACAGGG - Intronic
1051853062 9:21531527-21531549 GAGGAGACTCAGTTGGCACAAGG - Intergenic
1052150459 9:25108716-25108738 TAGGAGATAATGATGGGAGATGG - Intergenic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1055785497 9:79865316-79865338 AAGGAGGCTCAGATGAGACAAGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1057570606 9:96201599-96201621 CAGGAGCCACAGATGTGAAATGG + Intergenic
1059721668 9:116965861-116965883 TAGGAAGCACAGATGGTAAAGGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060765745 9:126294013-126294035 TGGGAGCCACAGATGGGTAAAGG + Intergenic
1060955422 9:127635513-127635535 TCGGAGACACAGATGTGGCTGGG + Intronic
1185611949 X:1398340-1398362 TAGCAGACACTGAAGGGAGAGGG + Intergenic
1188266981 X:28088885-28088907 CAAGTGCCACAGATGGGACAGGG - Intergenic
1189075953 X:37914579-37914601 GGGGAGACAGAGATGGGATAAGG + Intronic
1192215794 X:69157209-69157231 TGGGAGACACAGAGAGGAAAGGG + Intergenic
1194078212 X:89423999-89424021 TAGGAGTCACACATTGGCCATGG + Intergenic
1195156312 X:102126758-102126780 GAGGAGACAAAGAGGAGACATGG - Intronic
1195306324 X:103586603-103586625 GAGGAGACAAAGAGGAGACATGG - Intronic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1196712021 X:118772208-118772230 CAGGAGACATAGATGTGACTAGG - Intronic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198637710 X:138717718-138717740 TTGGGGACTGAGATGGGACATGG - Intronic
1199671345 X:150150848-150150870 AGGGAGCCTCAGATGGGACATGG + Intergenic
1199851791 X:151729126-151729148 TAGGAGACAGAGTTGGCCCATGG + Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200430859 Y:3079545-3079567 TAGGAGTCACACATTGGCCATGG + Intergenic