ID: 1155550572

View in Genome Browser
Species Human (GRCh38)
Location 18:26960761-26960783
Sequence TGGCAGAATTGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17492
Summary {0: 1, 1: 1, 2: 102, 3: 2033, 4: 15355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155550572_1155550578 24 Left 1155550572 18:26960761-26960783 CCTGGGCTTCAGCAATTCTGCCA 0: 1
1: 1
2: 102
3: 2033
4: 15355
Right 1155550578 18:26960808-26960830 CAGGCATGAACCACTATGCCAGG 0: 39
1: 1884
2: 26730
3: 84971
4: 163834
1155550572_1155550577 5 Left 1155550572 18:26960761-26960783 CCTGGGCTTCAGCAATTCTGCCA 0: 1
1: 1
2: 102
3: 2033
4: 15355
Right 1155550577 18:26960789-26960811 TTTCGAGTAGCTGGGATTACAGG 0: 76
1: 4121
2: 63871
3: 233696
4: 262831
1155550572_1155550573 -4 Left 1155550572 18:26960761-26960783 CCTGGGCTTCAGCAATTCTGCCA 0: 1
1: 1
2: 102
3: 2033
4: 15355
Right 1155550573 18:26960780-26960802 GCCATATCCTTTCGAGTAGCTGG 0: 1
1: 2
2: 14
3: 538
4: 12144
1155550572_1155550575 -3 Left 1155550572 18:26960761-26960783 CCTGGGCTTCAGCAATTCTGCCA 0: 1
1: 1
2: 102
3: 2033
4: 15355
Right 1155550575 18:26960781-26960803 CCATATCCTTTCGAGTAGCTGGG 0: 1
1: 3
2: 19
3: 697
4: 14272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155550572 Original CRISPR TGGCAGAATTGCTGAAGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr