ID: 1155553340

View in Genome Browser
Species Human (GRCh38)
Location 18:26990867-26990889
Sequence CCTGAAGAGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 684}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155553340_1155553345 22 Left 1155553340 18:26990867-26990889 CCTTCCTCCTTCTGCTCTTCAGG 0: 1
1: 0
2: 5
3: 87
4: 684
Right 1155553345 18:26990912-26990934 TGCTTGCTGCCTCCCCAGCGTGG 0: 1
1: 0
2: 2
3: 18
4: 198
1155553340_1155553346 26 Left 1155553340 18:26990867-26990889 CCTTCCTCCTTCTGCTCTTCAGG 0: 1
1: 0
2: 5
3: 87
4: 684
Right 1155553346 18:26990916-26990938 TGCTGCCTCCCCAGCGTGGCTGG 0: 1
1: 0
2: 0
3: 27
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155553340 Original CRISPR CCTGAAGAGCAGAAGGAGGA AGG (reversed) Intronic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900416084 1:2535426-2535448 CCTGAGGAGCTGAGGGAGGTGGG + Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
901757829 1:11452079-11452101 ACTGTAGAGCAGAAGCAGGCTGG + Intergenic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902300091 1:15495437-15495459 CCTGCAGAGCAGAAAGACCATGG - Exonic
903080452 1:20807392-20807414 CCTGCAGAGCAGAATGGGAAGGG - Exonic
903352307 1:22725023-22725045 CACCAAGAGCAGAAGGGGGAGGG - Intronic
903943848 1:26949821-26949843 CCTGAAGACCATGAGCAGGAAGG + Exonic
904052348 1:27647202-27647224 CCAGAGGAGCAAAAGAAGGAAGG + Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904480250 1:30788842-30788864 TGTGCAGAGCAGAAGGAGGAGGG + Intergenic
904630168 1:31835193-31835215 GCTGAAGAGGAGGAAGAGGAGGG + Intergenic
904811821 1:33168281-33168303 CCAGAAGAGTAGAAGGAAGAAGG + Intronic
904820002 1:33235879-33235901 CCTGACCAACAGAAGGAGGGAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905264303 1:36740384-36740406 CCTGGAGAGCAAGAGGTGGATGG + Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192196 1:43905574-43905596 CGGGAAGAGAAGCAGGAGGAGGG - Intronic
906192205 1:43905610-43905632 CGGGAAGAGAAGCAGGAGGAGGG - Intronic
906192214 1:43905646-43905668 CGGGAAGAGAAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906551294 1:46668330-46668352 CCTGAGGAGGAGGAGGAGGCGGG - Exonic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
906745971 1:48222448-48222470 CCAGATGAGCAGGAGGAGAAAGG - Intergenic
907705353 1:56827846-56827868 CCTGAAGAGCAGAAGGATAATGG + Intergenic
908070071 1:60450673-60450695 CATGAAGAGAAAAAGGAGGGTGG - Intergenic
908261858 1:62345270-62345292 CGTTAAGAGCAGATGGAGGCTGG + Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908916903 1:69138583-69138605 GCTGAAGAGCTGAGGGATGATGG - Intergenic
908960036 1:69685770-69685792 CCAGGAGAGGAGAAGGAGTATGG + Intronic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909933641 1:81527161-81527183 CCTAAAGAGCAGAACCAGGTTGG - Intronic
910068131 1:83178351-83178373 CCTGAGGAGGGGAAGGAAGATGG + Intergenic
910657456 1:89633145-89633167 CGCGAAGAGAAGTAGGAGGAAGG + Exonic
910734351 1:90435837-90435859 ACTGAATAGCAGAAGCAAGAAGG + Intergenic
911043081 1:93607402-93607424 CCTGAAGAGAAGGTGGAGGGAGG + Intronic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
912187257 1:107292971-107292993 TCTGAAGGGCATAAGGCGGAAGG - Intronic
912530125 1:110314542-110314564 CCTGGAGCCCAGACGGAGGATGG + Intergenic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
914096277 1:144546803-144546825 GCGGAAGAGCAGAAGGAGACTGG - Intergenic
914302239 1:146387160-146387182 GCGGAAGAGCAGAAGGAGACTGG + Intergenic
914880345 1:151541546-151541568 CCTCAAGAGCAGGATGAGGCAGG - Intronic
915713162 1:157920408-157920430 CCTTCAGAGCTGAAGGAGCAAGG - Intergenic
915744035 1:158142417-158142439 CCTGAAAAGCTGATGGATGAGGG - Intergenic
915910187 1:159910196-159910218 TCTAGAGAGCAGAGGGAGGAAGG + Intergenic
915911829 1:159920233-159920255 CCTGAAGAGGAGAAGACTGAAGG - Intronic
916004974 1:160651875-160651897 ACTCAAGAGAATAAGGAGGAAGG + Intergenic
916018232 1:160769466-160769488 CCTGAAGATGATAAGAAGGATGG + Intergenic
916086350 1:161272804-161272826 CCTGAGGAGGAGAAGGGTGATGG + Intronic
916289135 1:163144629-163144651 CGTGGAGAGGAGGAGGAGGAGGG + Intronic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
917906236 1:179589138-179589160 CCAGAAAAGCAGCAGCAGGAGGG + Intergenic
918139951 1:181711764-181711786 CCCAAGGAGCAGAAGGGGGAAGG + Intronic
918703741 1:187636759-187636781 TCTGAACAGCAGAAAGAGGGTGG + Intergenic
918995861 1:191758532-191758554 CCAGAAGTGGAGAAGGAGGGAGG + Intergenic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919795302 1:201318013-201318035 GTTAAAGAGCAAAAGGAGGAAGG + Intronic
919975345 1:202607140-202607162 CCTGAGGAGCAGAAAGAGCTTGG - Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920634941 1:207692748-207692770 CCTGAAGATCACAAAGAGGTTGG - Intronic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922707410 1:227796613-227796635 GCTGCAGAGCAGGAGGAGGTGGG + Intergenic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
922897920 1:229114852-229114874 CCTGAAGATGAGATGGAGAATGG - Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1062847936 10:722376-722398 AGTGAAGAGCAGGTGGAGGACGG - Intergenic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063443164 10:6089446-6089468 CATGAGGAGGAGGAGGAGGAAGG - Exonic
1063572801 10:7231762-7231784 CCCGAAGAGGAGGAGGAGGAGGG - Intronic
1063652479 10:7951815-7951837 ACTGAAGTTCAGAAGGATGAAGG + Intronic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1064452488 10:15455199-15455221 CCTGAATACCAAAGGGAGGAGGG - Intergenic
1065115908 10:22482207-22482229 CCTCAGGATCAAAAGGAGGAGGG + Intergenic
1065245164 10:23748806-23748828 CATGAAGAACAGAAGTAGGAAGG - Intronic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1065929618 10:30468172-30468194 GCTGAAGAGGCGAATGAGGAAGG - Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1068287465 10:54959147-54959169 GATGAAGAGAAAAAGGAGGAGGG + Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072566977 10:96624910-96624932 CCTAAATAGCAGAGGGAGTAGGG - Intronic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1074276448 10:112006870-112006892 GCAAAAGAGCAGAGGGAGGAAGG + Intergenic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074441533 10:113481410-113481432 TCTGAAGAGGAGAGGCAGGATGG + Intergenic
1075599990 10:123760784-123760806 GATGAAGAGGAGGAGGAGGATGG - Intronic
1075616282 10:123892526-123892548 CCTGGAGAGCAGAAGCCGCAGGG - Intronic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1077816021 11:5686046-5686068 CCAGAAGAGAAGAGAGAGGAAGG - Intronic
1078075829 11:8159517-8159539 ACTGAAGTGGGGAAGGAGGAAGG + Intronic
1078134138 11:8638405-8638427 CATGCAGAGTGGAAGGAGGAAGG - Intronic
1079996946 11:27305019-27305041 CATGAATAGCAGTAGGAGGCAGG + Intergenic
1080746656 11:35114374-35114396 CCTGATGATCACAATGAGGAAGG + Intergenic
1081908859 11:46687228-46687250 TCTGAAGAGCAGTGGGAAGAGGG + Intronic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082787333 11:57324340-57324362 GCCGAAGAGGAGGAGGAGGAGGG + Intronic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1083167852 11:60902465-60902487 CCTGAAGAGAAGAAAGGTGAGGG + Exonic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086931172 11:92694724-92694746 CCGGAAGAGCAGCAGGGTGAAGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088033131 11:105276644-105276666 GCTGAAGAGAAGGAGGAAGAGGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088712948 11:112524776-112524798 CCTGAGGAACTGAAGAAGGAAGG - Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089697589 11:120225639-120225661 CCTGAAGAAGGGCAGGAGGATGG - Exonic
1089794220 11:120967340-120967362 CCTCTAGGGCAGGAGGAGGATGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091714113 12:2764807-2764829 GCTAAAGAGCAGAAGGAAGAAGG + Intergenic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1091813468 12:3418819-3418841 CTTGAAGAGGAAAAGGATGAGGG + Intronic
1091827696 12:3525334-3525356 GCTGAAGAGCAGGAGGGGGCTGG + Intronic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1093203178 12:16214514-16214536 TCTGGGGAGCAGAAGGAGGGTGG + Intronic
1095323162 12:40854794-40854816 TCAGAAGAGCAGATGGCGGAAGG + Intronic
1096512887 12:52141497-52141519 TCTGAAGACCTGAAGGAGGCGGG - Intergenic
1096688180 12:53303012-53303034 CCTGAGGAGCATAGGGAGGTGGG - Exonic
1096694203 12:53338515-53338537 ACTGAAGGGGAAAAGGAGGAAGG + Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1097638335 12:62148538-62148560 CCAAAAGAGGGGAAGGAGGAAGG + Intronic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098782809 12:74708380-74708402 CCTGAAGAGCACGGTGAGGAAGG - Intergenic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099398151 12:82167800-82167822 CCTAGAGAGGAGAAGGAAGAGGG + Intergenic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099494062 12:83322882-83322904 TCTGATGAGTAGATGGAGGAAGG + Intergenic
1099652950 12:85451892-85451914 ACTGAAGAGGTGAAGGAGGTAGG - Intergenic
1099694628 12:86002120-86002142 ACTGAAGGGCTGAAGCAGGAAGG - Intronic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1101538399 12:105641810-105641832 CCAGAAGTCCAGAAGGAGGCAGG + Intergenic
1101553531 12:105785492-105785514 TCAGCAGAGCAGAAGGAAGAAGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102255942 12:111415071-111415093 CCTGAAGAGAGGATGAAGGAGGG + Intronic
1102372219 12:112391557-112391579 ACTGGAGATCAGAAGGATGAGGG - Intergenic
1102575026 12:113850759-113850781 CCTGAGGAGCAGAAGGGGCCAGG - Intronic
1102793641 12:115669870-115669892 CCAAAAGTGCTGAAGGAGGAAGG - Intergenic
1102822966 12:115923847-115923869 ACAGAAGAGGAGAAGGAGAAGGG - Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103308716 12:119988567-119988589 CCTAGAGAGCAGTAGGAGGAGGG - Intergenic
1103555786 12:121765777-121765799 CCTGAGGAGGAGCTGGAGGAGGG - Intronic
1104166013 12:126230328-126230350 CGTGAAGAACAGAAGTGGGAGGG + Intergenic
1104745971 12:131210798-131210820 TGTGAAGAGCAGAGGCAGGAGGG + Intergenic
1105284577 13:18993821-18993843 CCTGAAGGCCAGAAGTAAGAAGG + Intergenic
1105284727 13:18994724-18994746 CCAGAAGGTTAGAAGGAGGAAGG + Intergenic
1105609267 13:21954031-21954053 CCTGAAAAGAAGGAGCAGGAAGG - Intergenic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106606205 13:31231623-31231645 CCAGAAGAACAGAAGGGGAAAGG - Intronic
1107368339 13:39711589-39711611 ACTGATGAGAAGGAGGAGGAAGG - Intronic
1107383666 13:39884076-39884098 TCTGAAGAGCAGAAAGAAAAAGG + Intergenic
1107701672 13:43054936-43054958 CCTGGAGCACAGAAGGAGGGCGG + Intronic
1107814619 13:44233108-44233130 CCTGGAGAGCTAGAGGAGGATGG + Intergenic
1108184037 13:47871011-47871033 CCTGTTGAGTAGAAGGAGTAAGG + Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1109151069 13:58847770-58847792 TCAGAAGAGGAGAAGCAGGAAGG + Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110324307 13:74196321-74196343 GCAGGAGATCAGAAGGAGGAGGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111675072 13:91376839-91376861 CCTGAAGAGAAAAAGGGTGAAGG + Intergenic
1112022727 13:95385596-95385618 CCTGAAGGTCAGAAGCAAGATGG - Intergenic
1113166520 13:107449353-107449375 CCTGAAAATCAAAAGTAGGAAGG + Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113708958 13:112451871-112451893 CCTGGAGAGCATCAGGAGGCTGG + Intergenic
1114146062 14:19979652-19979674 GCTGAATAGCAGAAAAAGGATGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114746318 14:25151708-25151730 GCTGCAGGGGAGAAGGAGGAGGG + Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1115704746 14:35987549-35987571 CCTGAAGGTCAGAAGCAAGATGG - Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117654379 14:57939463-57939485 CCTGGAGACCAGAAGAAGAAAGG + Intronic
1118276120 14:64387744-64387766 CCTCCAGAGCAGAACGCGGAGGG + Intergenic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1118620423 14:67609779-67609801 CTTGAAGAGAAGAAGGGGAAGGG + Intergenic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1118906572 14:70027881-70027903 CCTGCAGAGCAGAGGGATGGAGG - Intronic
1119017698 14:71076515-71076537 CCAGAAGATCAGAAAGAGGAAGG - Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119171936 14:72542214-72542236 CCCCAAGAGCAGGAGGAGCATGG - Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119707025 14:76789277-76789299 TCTGAAGAGCAGAAGGGGTTGGG + Exonic
1119740112 14:77008640-77008662 CCTTAAGAGCTGAAGGATTAAGG - Intergenic
1119898363 14:78239568-78239590 CTTGAAGAACAGCAGGAGGTAGG - Intergenic
1120408587 14:84121040-84121062 CCTGAAGCCCACAAGGTGGAGGG + Intergenic
1120703829 14:87727043-87727065 GCAGAAGAGGAGAAGGAGGTAGG + Intergenic
1121412954 14:93760467-93760489 TCTGAAGAGCAGAATAGGGAGGG - Intronic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1202917963 14_KI270723v1_random:2823-2845 CCTGAGGAGCACCAGGAGGCCGG - Intergenic
1202926661 14_KI270724v1_random:31760-31782 CCTGAGGAGCACCAGGAGGTCGG + Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1124868812 15:33520446-33520468 CCTGATGAGGAGGAGGAGTATGG + Intronic
1125095046 15:35841123-35841145 CCTGATGGGCATTAGGAGGAAGG + Intergenic
1125500693 15:40238909-40238931 GCTGAAGGGGAGGAGGAGGAAGG - Intronic
1125538806 15:40458180-40458202 CCTGAAGAGCCTAGGGAGCAAGG - Intronic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1126559245 15:50025444-50025466 CCTGTGGAGGGGAAGGAGGATGG - Intronic
1126927392 15:53605335-53605357 ACTGAAGAACAGAAGGTGGGAGG + Intronic
1127002088 15:54520885-54520907 TCTGAAGATCAAAAGAAGGAAGG + Intronic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127439106 15:58988136-58988158 CCTGGAGGGGAGAAAGAGGAAGG + Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1128788850 15:70417968-70417990 GATGAAGAGGTGAAGGAGGAGGG - Intergenic
1128965248 15:72051831-72051853 CATGAACAGCAGGAGGAGGCAGG + Intronic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129710554 15:77818598-77818620 CCTGAGGAGCAGAAGGCGCGGGG + Intronic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131826815 15:96328625-96328647 CCTAAAGAGGATAAGAAGGATGG - Intronic
1132143737 15:99414776-99414798 CCTGAAGCGCAGGAGGTGGTAGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1133175361 16:4010336-4010358 CCTGAAGAGCTGGAGCACGACGG + Intronic
1133404150 16:5509688-5509710 CCAGGAGAGCTGATGGAGGAGGG + Intergenic
1134325580 16:13204607-13204629 CCTGAAGAGCAGAAGTTGCCTGG - Intronic
1134403590 16:13935433-13935455 CCTGAAGAACTGGAAGAGGAAGG + Exonic
1134780097 16:16887684-16887706 GCTGAATAGGAGATGGAGGAAGG + Intergenic
1135937858 16:26796326-26796348 CCAGCAGGGCAGCAGGAGGAAGG + Intergenic
1136062522 16:27736517-27736539 CCTGAACAGAAGAAGGAGCAAGG + Intronic
1136548566 16:30969307-30969329 CCTGAACAAGAGAAGGAGGCTGG + Exonic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138364499 16:56463091-56463113 TCTGAAGAGAAGAGGGAGCAGGG - Intronic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140247795 16:73267168-73267190 GCGGAAGGGCAGAAGGAGAAGGG + Intergenic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140297327 16:73721599-73721621 GCTGAAGAGCAGATGGTGCATGG - Intergenic
1140453727 16:75092257-75092279 GCTGAAGAGGAGGAGGAGGAGGG + Intronic
1140491446 16:75339646-75339668 CCTAAAGGGCAGAAGGCTGAGGG - Intronic
1140509038 16:75494386-75494408 CCTGAAGAGCAGAAAGGAGTTGG - Intronic
1140862619 16:79031364-79031386 CCTGAAGAAAAGAAGGAGGCAGG - Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141354610 16:83333441-83333463 CCAGAAGAGCAGGGGGAGGCTGG - Intronic
1141596501 16:85100153-85100175 ACTGAAGAACAGATGGAGGGGGG + Exonic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142137757 16:88459541-88459563 AATGAAGAGAAGGAGGAGGAAGG - Intronic
1142199875 16:88755982-88756004 CCAGGACAGCAGAAGAAGGAAGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142779479 17:2169843-2169865 ACTGAAGAGTAGAAGGGGGAAGG + Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143318552 17:6052425-6052447 CCTGAAGCGCAGGATGAGGAGGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143476615 17:7206964-7206986 CCAGAAGAGGAGATGGAGGAAGG + Intronic
1143542596 17:7578533-7578555 GCTGAGGAGCAGCAGGAGGGGGG + Exonic
1143798922 17:9361505-9361527 GGTGAAGAGCAGCAGGAGTAGGG + Intronic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1144971224 17:19111068-19111090 CCTGGAGCGCAGGAGGCGGAGGG + Intergenic
1144991526 17:19237231-19237253 CCTGGAGCGCAGGAGGCGGAGGG + Intronic
1145837197 17:27963547-27963569 CATGAAGGGCAAGAGGAGGAAGG + Intergenic
1147110343 17:38257063-38257085 GCTGAAGACGAGAAGGAGGAGGG + Intergenic
1147261325 17:39211059-39211081 CCTGGAGAGAAGCAGGAGAAAGG + Exonic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147614487 17:41820147-41820169 CCTGAGGATCCAAAGGAGGATGG - Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148047677 17:44753934-44753956 CTAGAAGAGCAGCAGAAGGAAGG + Intergenic
1148074211 17:44926348-44926370 GATGAAGACAAGAAGGAGGAGGG - Intronic
1148119152 17:45197569-45197591 CCTGTAGAGGAGGAGGAGGAGGG + Intergenic
1148390049 17:47265425-47265447 CCAGAAGATAGGAAGGAGGAAGG - Intronic
1148419167 17:47531368-47531390 GCTGAAGACGAGAAGGAGGAGGG - Exonic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148807604 17:50272184-50272206 CCTGAAGAGGGGCAGGAGGAGGG - Intronic
1148889063 17:50794659-50794681 CCTGGAGAGAACAAGGAGAATGG - Intergenic
1149452587 17:56761362-56761384 CTCGAAGAGCAGAAGTAGGCTGG - Intergenic
1149530315 17:57389882-57389904 ACAGAAGAGCAGAAGGAGCCTGG - Intronic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1149997638 17:61413084-61413106 CCTGAAGAGCCGGATGAGGGTGG - Exonic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1151280902 17:73073378-73073400 CCTGAAGAGGACATGGGGGAGGG - Intronic
1151441586 17:74132805-74132827 CAAGAAGAGAAGGAGGAGGAAGG + Intergenic
1151579787 17:74971580-74971602 CCTGGAGAGCAGGAGGTGGGGGG + Intronic
1151816558 17:76474142-76474164 CCTGGAGGGCAGAAGAAGGCTGG + Exonic
1151821716 17:76500540-76500562 TCTGAGGAGCAGAAGGCGGTGGG - Intronic
1151823962 17:76513185-76513207 GCTCAAGAGGAGGAGGAGGAAGG + Intergenic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152007620 17:77692439-77692461 GCTGAAGAGGAGGATGAGGAGGG + Intergenic
1152259376 17:79258801-79258823 TCGGCAGAGCAGGAGGAGGATGG - Intronic
1152697260 17:81803582-81803604 CCTGCAGAGCAGACGGGGGCTGG - Intergenic
1153520908 18:5953162-5953184 CCTGCAGAGCATCAGGAGAAGGG + Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1154220370 18:12447843-12447865 CCAGAAGGGCACAAGGGGGAAGG - Exonic
1154507915 18:15060855-15060877 CTTGAACAGCAGTAGAAGGATGG + Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1156756400 18:40532129-40532151 TCAGAAGAGAGGAAGGAGGATGG - Intergenic
1157204884 18:45689421-45689443 TCTGAAGAACTGAAGGAGGTGGG + Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1157917458 18:51680225-51680247 CATCAAGAGAAAAAGGAGGAAGG + Intergenic
1158480060 18:57814241-57814263 GCTGAAGAGGAGAGGAAGGAGGG - Intergenic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1160799541 19:961293-961315 CCGGAAGGGAAGGAGGAGGAGGG + Intronic
1160822562 19:1065312-1065334 ACCGAAGAGCAGAAGGAGGCAGG + Exonic
1161021058 19:2011750-2011772 GCTGAGGAGCAGGAGCAGGAGGG - Intronic
1161476440 19:4488504-4488526 CCAGAAGAGCCGAAGAACGAAGG - Intronic
1163092917 19:15033688-15033710 CCTGCAGCACAGAGGGAGGAGGG - Intergenic
1163286606 19:16352343-16352365 CCCGAGGAGGAGGAGGAGGAAGG - Intergenic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165938401 19:39403202-39403224 CCTGAGGATCTGAGGGAGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1167050575 19:47075448-47075470 ACTGAAGAGGAGGAGGAGGAGGG - Intronic
1168714659 19:58519737-58519759 CCTGAAGAGGAGTCGGAGGTGGG - Exonic
924969611 2:113608-113630 CCTGAAGATGACAAGCAGGATGG - Intergenic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
925148133 2:1594654-1594676 CGCGAAGAGCAGAATGAGAAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925612977 2:5718682-5718704 CCTGAAGGACACAGGGAGGATGG - Intergenic
926163296 2:10502790-10502812 CTTGCAGAGCTGTAGGAGGAGGG - Intergenic
926301736 2:11609697-11609719 CATGAAGAAAAGGAGGAGGATGG + Intronic
927108900 2:19850454-19850476 GCTGCAGAGCAGAGGGAGCAGGG - Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
929355857 2:41023457-41023479 TCTGAAGAGGAAAAGGAGAATGG - Intergenic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
931214457 2:60228175-60228197 CCTGCAGAGGAGAAGGACCACGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
931630715 2:64296140-64296162 CATGAAGAGCAGAATAGGGAAGG - Intergenic
933313953 2:80693602-80693624 CAAGAAGAATAGAAGGAGGAAGG + Intergenic
933737334 2:85505681-85505703 GCTGGAGAGCAGGAGGTGGAAGG - Intergenic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935013170 2:99154908-99154930 CCTGAAGCGCAAGAGAAGGAGGG - Exonic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935146256 2:100397601-100397623 CCTGAAGAGACAAAGGAGGGGGG + Intronic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937365424 2:121257505-121257527 CCTGAAGAGCAGCAGGGGGCAGG + Intronic
937454379 2:122028696-122028718 CCAGAAGAGCAGGAGGAGACGGG - Intergenic
937472191 2:122183658-122183680 CCTGAAGAGGAGAAGGTGAATGG + Intergenic
937925005 2:127161309-127161331 TCTGAAGAGCAGAGAGAGGCTGG + Intergenic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
938235618 2:129704166-129704188 CCAGAAGAGGAGAAGGAGGGAGG - Intergenic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
938995057 2:136669634-136669656 ACAGAAGAGCAGAAGCAGTATGG - Intergenic
939355455 2:141095827-141095849 CATGAATATCAGATGGAGGAGGG - Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939971343 2:148664637-148664659 CCTGAAGACCAGGAGGTGGAGGG - Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940092728 2:149938944-149938966 GCTGCAGAGCAGAAGGAGGGAGG - Intergenic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943971844 2:194419794-194419816 CATCAAGGGCAGAAGTAGGAAGG + Intergenic
944303453 2:198152138-198152160 CCAGAAGGGCAAAAGGTGGAAGG + Intronic
944868474 2:203885161-203885183 CCTCTAGAGCAGAAGGGGGTTGG + Intergenic
946002103 2:216491034-216491056 ACTGCAGAGCAGTAGGTGGAAGG - Intergenic
946386112 2:219385531-219385553 CCTGAAGAGCAGAAAGATGCTGG + Exonic
946398218 2:219454061-219454083 CATGAAGAGCAAGAGGGGGAGGG - Intronic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947536385 2:230942627-230942649 CCAAAAGAGCAGAGGGAGGGTGG + Intronic
947559720 2:231138059-231138081 CTTGAAGAGCAGCAGGACTAGGG - Intronic
947645761 2:231738476-231738498 CCTGAAGTAAAGAAGAAGGAAGG - Intronic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948145563 2:235705550-235705572 CCTGTAGTGGAGTAGGAGGAAGG + Intronic
948190081 2:236051640-236051662 CCCAAAGAGCAGAAGCAGGAAGG + Intronic
948502773 2:238407106-238407128 CCCGAGGAGGAGGAGGAGGAGGG + Intergenic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948654868 2:239470345-239470367 CATAAAGAGCAGAAAGAGGCTGG - Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
1168880605 20:1203364-1203386 TCTGAACAGAACAAGGAGGAAGG - Intergenic
1169264133 20:4157407-4157429 CCTGCAGAGGAGAAGAAAGAGGG + Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170008425 20:11694196-11694218 CCTGCAGACCACAAGCAGGAAGG + Intergenic
1170744942 20:19090997-19091019 CCTTAAGAGAAGAAGGAGAGAGG + Intergenic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1171781924 20:29427483-29427505 CCTGAGGAGCACCAGGAGGCCGG - Intergenic
1172167267 20:32907013-32907035 CCTGAGGAACAGAAGGAGTCAGG - Intronic
1172354670 20:34271236-34271258 TCTGAAAAGGAGAAGGAGGTGGG - Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173062407 20:39675044-39675066 CCTCGAGAACAGAAAGAGGAAGG - Intergenic
1173092365 20:39985441-39985463 CCTGAACAGCGGATGGAGTAGGG - Intergenic
1173754332 20:45501837-45501859 CATGAAGAGTAGAAGCAGGCAGG + Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1174695571 20:52553180-52553202 CCTGAAGAGCATATGGATAAAGG + Intergenic
1174733841 20:52945083-52945105 GCTGAGGAGGAGAAGGAAGAGGG + Intergenic
1175156996 20:56977846-56977868 TCTGTAGAGCAGAGGGAGGGAGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1176205569 20:63886267-63886289 CCTGAAGGGAAGCACGAGGAGGG - Intronic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1177665228 21:24147950-24147972 ACTGAAGAGGATAAGGAGAAAGG - Intergenic
1177989344 21:28019153-28019175 CTTGAACAGCAGGAGAAGGATGG - Intergenic
1178252765 21:31020512-31020534 GCTGAACAGCAGAAGGAGCTGGG + Intergenic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179540245 21:42079160-42079182 CCTGCAGAGCGGGAGCAGGAAGG - Intronic
1179782523 21:43711139-43711161 CCAGAAGAGGAGAGGGAGAAAGG + Intergenic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181652998 22:24271161-24271183 CCCGAAGCCCAGAACGAGGACGG - Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184721187 22:46314478-46314500 TCTGAAGAGCAGAAAGGCGAAGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
949152688 3:789670-789692 CCTGAAGAGAACAAGGATAAAGG - Intergenic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949812473 3:8020743-8020765 CCAGTAGGGAAGAAGGAGGAGGG + Intergenic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
954575872 3:51675941-51675963 GCTGAAGGGCAGGTGGAGGAGGG + Intronic
954653364 3:52178692-52178714 CCTGAGGAGCAGCAGGCAGAAGG + Intergenic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956783651 3:72624417-72624439 CCTGAAGAGCTTAGGGAGGAAGG - Intergenic
957083575 3:75658914-75658936 CCTGAGGAGCACCAGGAGGCCGG + Intergenic
957287076 3:78230761-78230783 GCTTCAGAGGAGAAGGAGGATGG + Intergenic
957550201 3:81694505-81694527 ACTGGAGAGTAGAAGGAGGCGGG - Intronic
957790077 3:84929434-84929456 CCTGAAAAGCTGTGGGAGGATGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958856318 3:99390509-99390531 TCTGAAGACCAGAAGGAAGCAGG - Intergenic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962600022 3:136984638-136984660 GCTGAAGAGCAGAGGAGGGAAGG + Intronic
963698941 3:148599926-148599948 CCTGAAGAGCAGCAGGACTTAGG - Intergenic
963928596 3:150978181-150978203 CCTGAAGAGGTGAAGAAAGAAGG + Intergenic
964006267 3:151832970-151832992 CAAGAAGAGCAGGAGGAGGGAGG + Intergenic
964452676 3:156826639-156826661 CCGGAAGAGGAGGAGGAGGAGGG - Exonic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966211183 3:177454928-177454950 CATGAAGGGAAGAAAGAGGAAGG - Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
967864927 3:194182255-194182277 GAAGAAGAGCAGAAGTAGGAGGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968332701 3:197885176-197885198 TCTGAGGAGCAGCAGGAGGGCGG - Intronic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
969461233 4:7330160-7330182 CCTGTAGAGCAGGAGGAAGAGGG - Intronic
969828702 4:9778634-9778656 CCTGAAAAGCCGGAGGAGGGAGG - Intronic
969929812 4:10620048-10620070 CGTGAAGAGCAGAGAAAGGAAGG - Intronic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970415151 4:15849525-15849547 CATGAAGAGGAGGAGGAAGACGG - Exonic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970950512 4:21750082-21750104 CCTGGAGAGAGGGAGGAGGATGG - Intronic
971004203 4:22356283-22356305 CCTTAAGAATAGAACGAGGAGGG + Intronic
971033368 4:22666045-22666067 CCTTAAGACCAGAAAAAGGAGGG - Intergenic
971120953 4:23704447-23704469 CCTGAAGAGTAGAAGCATGAAGG - Intergenic
971216795 4:24669708-24669730 GCAGAAGAGAAGAAGGAGGAAGG - Intergenic
972202021 4:36724538-36724560 CCTGAAGTGAGGAATGAGGAGGG + Intergenic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
972918519 4:43907806-43907828 CCACAAGAGCACTAGGAGGATGG + Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
973831823 4:54769041-54769063 CCTGAAGAATAGAAGTAGAATGG + Intergenic
973849528 4:54947455-54947477 CCTGAAGAGAACAAAGAGGCTGG - Intergenic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
976334097 4:83865551-83865573 CCTGAAGGGAAGAATGAGGTGGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
978395259 4:108272285-108272307 CCTTAAGAGAAGAAGGCTGAGGG - Intergenic
980220298 4:129904184-129904206 CCTGAAGGGCAGATGCAGGCAGG - Intergenic
980457632 4:133066156-133066178 CCAGAAGAGGAGAAAGATGAAGG - Intergenic
981290815 4:143072229-143072251 CCTGAACAGGAGAAAGATGAAGG + Intergenic
981615056 4:146637438-146637460 CCTAGAGAGCGGAAGGAGCAGGG - Intergenic
982107347 4:152022536-152022558 GATGAAGAGCAGTAGGCGGAGGG - Intergenic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
982634435 4:157875107-157875129 CCTTAAGAACAGAGGAAGGATGG - Intergenic
982767035 4:159360828-159360850 CCTGAAGAGGAGCGGGAGGAAGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985693652 5:1327549-1327571 CCTGTAGAGCAGGAGCTGGATGG - Intronic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
986135808 5:4976655-4976677 CCTGTAGAGCTGAAGGCGGAAGG - Intergenic
986314747 5:6579136-6579158 CCTGAAGAGAAAAATGTGGATGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986845033 5:11742251-11742273 CCTGAAGAGAAGGAACAGGACGG - Intronic
986883307 5:12202931-12202953 CCTCAAGAGTAGAGGGATGAAGG - Intergenic
987117402 5:14736631-14736653 CGTGAAGGTCAGAAGGAGAAGGG - Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990114179 5:52368388-52368410 CCTGGAGTGCAGCAGGAGTAAGG - Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992242158 5:74783341-74783363 CCTTAAGAGCAGTGGGAGTACGG - Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995425333 5:112015055-112015077 TCTGGAGAGCAGAAGGAGGTTGG + Intergenic
995548209 5:113253575-113253597 GCAGATGAGCACAAGGAGGAGGG + Intronic
995859817 5:116629421-116629443 CCTGATGATCAGGAGGAGGTGGG + Intergenic
996382421 5:122875730-122875752 TCTGAAAAGCAGGAGGAGAATGG + Intronic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
996879824 5:128283591-128283613 CCTGGAGAGTAGGAGGAGCAGGG - Intronic
997571980 5:134936603-134936625 CCTGAAGAGAAAAAGGATCATGG - Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998490163 5:142539591-142539613 GAAGAAGAGGAGAAGGAGGAGGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999649108 5:153748270-153748292 CCTGAAGGGTAGTAGGAGGCAGG + Intronic
999708835 5:154298261-154298283 CCTGAAAAGAGGAAGGAGGCTGG - Intronic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000293369 5:159891700-159891722 GCTGAAGACCTGAGGGAGGAGGG - Intergenic
1000694491 5:164363080-164363102 CCTGAAGAAGAAGAGGAGGAGGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001282494 5:170397104-170397126 CCTGAATACCAAAGGGAGGAAGG + Intronic
1001536914 5:172504454-172504476 CCTGAAGCTCAGAAGCTGGATGG + Intergenic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1002357360 5:178641621-178641643 CCTGATGATCAGGAGGAGGCCGG - Intergenic
1003697237 6:8421803-8421825 CCTGGAGAGTAGAAGAATGAAGG + Intronic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1003830581 6:10005689-10005711 ACTGAAGACGAGCAGGAGGAAGG + Intronic
1003846038 6:10174271-10174293 TCTCAAGAGCTGAAGGAGGCAGG + Intronic
1004703897 6:18104829-18104851 CGAGAAGAGCAGGAGCAGGAAGG + Intergenic
1005274857 6:24205798-24205820 CCTGAAGAAGAGAAGGCTGAGGG - Intronic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005859069 6:29887774-29887796 CCCTGAGAGCAGCAGGAGGAGGG - Intergenic
1005864227 6:29926480-29926502 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1005875294 6:30006619-30006641 CCCCGAGAGCAGCAGGAGGAGGG - Intergenic
1005905532 6:30259647-30259669 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1005955376 6:30659834-30659856 CCTGGAGAGCAGAAAGAGATGGG + Exonic
1006730654 6:36233741-36233763 CCTGAAGAGCAGAAGCAGAGGGG + Intergenic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007122134 6:39391178-39391200 TCTGAAGACCAGAAGTAGGACGG + Intronic
1007346688 6:41236464-41236486 CCTGCAGGGAAGAAGGAGAAAGG - Exonic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1008002020 6:46370605-46370627 CCTGTAGGGCCAAAGGAGGAAGG - Intronic
1008057908 6:46964163-46964185 CCAGAAGAGAGGAAGAAGGAGGG - Intergenic
1008072183 6:47108956-47108978 TCTGAAGAGGAGATGGATGATGG + Intergenic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009905748 6:69867808-69867830 GCTGGAGAGCAAAAAGAGGAGGG + Intronic
1011025182 6:82860928-82860950 CCTGAAGAGCAAAAAGAAGCTGG + Intergenic
1011071607 6:83391737-83391759 CCTGGAGACCAGAAGCAGGATGG - Intronic
1011525813 6:88263763-88263785 GCTGCAGGGCAGAAGGAGGGAGG + Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1012849771 6:104432463-104432485 CTTGAAGAGTAGAAGGATCAAGG + Intergenic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1013075594 6:106768296-106768318 CAAGAAGAGCAGAAGAGGGAAGG + Intergenic
1014062342 6:117086199-117086221 CCAGAAGAAGAGAAGGAAGAGGG + Intergenic
1014214954 6:118744579-118744601 CCTGGAGAGCAGAAAGAGGTTGG - Intergenic
1014528062 6:122524164-122524186 GATGAAGAGGAGGAGGAGGAAGG - Intronic
1015861916 6:137690322-137690344 CCTAAAGAGCAGAAGGGAGTGGG + Intergenic
1016372951 6:143393297-143393319 CCTGGAGAGGAGGAGAAGGAAGG + Intergenic
1016640150 6:146338870-146338892 AGAGAAGAGAAGAAGGAGGAAGG - Intronic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016865071 6:148758295-148758317 GCAGAAGAGAAGAAGCAGGAAGG - Intronic
1017074862 6:150608331-150608353 CCTGAGGAACAGAAGGAGACTGG + Intronic
1017085023 6:150705720-150705742 CCTCAGGAGCATAAGGAGGAGGG - Intronic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017802496 6:157910115-157910137 CCTGTAGAGCAGCAGGATGCAGG + Intronic
1018115168 6:160576232-160576254 CTTGAAGAGCAAAAGCAGGAAGG - Intronic
1018116272 6:160589018-160589040 CATGAGGGGCAAAAGGAGGAAGG - Intronic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1018601808 6:165552130-165552152 CTTGAAGTGTAGGAGGAGGAGGG - Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019404928 7:877964-877986 CCTGAAGGCCAGGAGGAGGGAGG - Intronic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1019597340 7:1864246-1864268 CCTGAACACCTGAAGGAGGAGGG + Intronic
1019853916 7:3585557-3585579 CCTGAAGAGGAAGAGGAAGAGGG + Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022633844 7:32112290-32112312 GAAGAAGAGGAGAAGGAGGAGGG - Intronic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024130716 7:46350200-46350222 CCTGGAGAGCAGTAAGAGGAAGG + Intergenic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1024469530 7:49752667-49752689 ACAGGAGAGAAGAAGGAGGATGG + Intergenic
1024578442 7:50782839-50782861 CCTGAGGAGCGGGAGGACGACGG + Intronic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026689696 7:72540953-72540975 CCTGAACAGAATCAGGAGGAAGG - Intergenic
1026879720 7:73900795-73900817 CCTGAGGAGCAGGAGAAGAAAGG - Intergenic
1027275967 7:76556408-76556430 CCTGAGGAGGGGAAGGAAGATGG - Intergenic
1027440691 7:78216338-78216360 TGTGAAGAGCAGATGGATGAAGG - Intronic
1028799963 7:94951675-94951697 CCAGAAGGACAGTAGGAGGAAGG - Intronic
1029409638 7:100400630-100400652 GATGAAGAGCAGAACCAGGATGG + Intergenic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029736553 7:102468702-102468724 CCTGAACAGCAGCATGGGGATGG + Intronic
1029889833 7:103915898-103915920 TCTGCAGAGCAGAAAAAGGATGG + Intronic
1030737371 7:113065568-113065590 TCTGGAGAGAAGAAGGAAGAAGG + Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032252148 7:130267299-130267321 CCAGAAGAGCAGGAGGAGGTGGG - Intronic
1032642362 7:133783983-133784005 CTTTAAGAGCAGAAGGATGGGGG - Intronic
1032745753 7:134784366-134784388 GCTGAAGACCAGAAGGACCAAGG + Intronic
1034494815 7:151413411-151413433 CCCGAAGAACAAGAGGAGGAGGG + Intergenic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1035921025 8:3676320-3676342 TCTGAAGAGCAGGTGGAGGTGGG + Intronic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036103989 8:5819946-5819968 CCTATAGAGAAGAATGAGGAAGG - Intergenic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1036700656 8:11011734-11011756 AGTAAAGAGCTGAAGGAGGAAGG + Intronic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038483654 8:27918848-27918870 GAAGAAGAGGAGAAGGAGGAGGG + Intronic
1038489280 8:27958290-27958312 CCGGAAGAGGGGGAGGAGGAGGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039317309 8:36387812-36387834 GGAGAAGAGCAGGAGGAGGAAGG - Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1040099732 8:43488180-43488202 GCTGAAGAGGAGAAAGAGGGAGG + Intergenic
1040416001 8:47196685-47196707 GCTGGAGAGCAGTAGGGGGATGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1041807257 8:61865543-61865565 GCTGAAGACCAGAAGGGAGAAGG + Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1044390255 8:91641594-91641616 AATGAAGAGCATAAGGAGGCAGG - Intergenic
1044586030 8:93869808-93869830 CCTGAAGGGAAGAAGGGAGAAGG - Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1046339930 8:112840414-112840436 GCTGGAGAGAATAAGGAGGAAGG + Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1047219050 8:122903982-122904004 CCTGAAAAGTGGAAGGAAGAAGG + Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047549494 8:125854445-125854467 CATGAAGAGAATAAGGAGCACGG + Intergenic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1048803103 8:138212491-138212513 CCTGAAAAGCAAAAGGCAGAGGG - Intronic
1048941055 8:139401204-139401226 CCTGAAGTGGAGAAAGAAGATGG + Intergenic
1049122006 8:140747610-140747632 GCTGAAGAGGAAGAGGAGGAAGG + Intronic
1049311588 8:141936529-141936551 CCAGCAGAGCAGCAGGGGGAAGG - Intergenic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1051033463 9:12713222-12713244 ACTGAAGGGTAGAAGGAGGCAGG + Intergenic
1051477153 9:17520407-17520429 CCTAAAGAGCTGGAGCAGGAAGG + Intergenic
1052565443 9:30144071-30144093 TCTGAACAGAAGAAGAAGGAGGG - Intergenic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1053084678 9:35208682-35208704 CCAGAACAGCACAAAGAGGATGG + Intronic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1056340611 9:85627698-85627720 GCTGAAGAGCAGGAAGAAGAAGG - Intronic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058606172 9:106725966-106725988 CCTGAAGATCAGAAATAGGGAGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060239880 9:121893929-121893951 TCTGAAGAGCAGCTGCAGGATGG + Intronic
1060556790 9:124512160-124512182 CCTGGAGAGCTGGAGGTGGAGGG + Intergenic
1060849042 9:126860233-126860255 CCTGAAGAGATGCAGGAGGGAGG + Intergenic
1062229224 9:135472175-135472197 CCTGAAAGGCAAAAGGAGGTTGG - Intergenic
1062299455 9:135856916-135856938 CCTGAAGAGGAGGTGGAGGGAGG - Intronic
1062367530 9:136218382-136218404 CCTGGAGAGTAGATGGAGGAGGG - Intronic
1203773176 EBV:59578-59600 TCTGAGGAGGAGAAGGAGAATGG + Intergenic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1187601840 X:20839777-20839799 CCTGAAGGGCAAGAGGATGAAGG + Intergenic
1188633141 X:32393326-32393348 ACTGAAGAGCATAAGGAGTTTGG + Intronic
1190265710 X:48826418-48826440 CCTGAGGAGCCGAGGGAGGGCGG + Intergenic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1193919451 X:87407228-87407250 CCCCAAGAGCACAAGGAGGCTGG + Intergenic
1194235559 X:91379516-91379538 CCTGAGGAGCCCAAGGAGGCTGG - Intergenic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1195976479 X:110532880-110532902 GCTGAAGAGCAGAAGGCAGTGGG - Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196387435 X:115173796-115173818 GCTGAAGAGGAGGAAGAGGAGGG - Intronic
1198329455 X:135608405-135608427 CCTGAAGAGAAGATGGAAAATGG + Intergenic
1198333100 X:135640422-135640444 CCTGAAGAGAAGATGGAAGATGG - Intergenic
1198333263 X:135641973-135641995 CATGAAGAGCAGATGGAGAATGG - Intergenic
1199351103 X:146802005-146802027 CCAGAAGACCAGAAAAAGGATGG + Intergenic
1199352804 X:146822488-146822510 CCAGAAGACCAGAAAAAGGATGG - Intergenic
1199684489 X:150254379-150254401 GCTGAAGAGCAGGAGGAGGCTGG - Intergenic
1199686046 X:150266565-150266587 CCAGAAGAGCAGAGGCAGTAAGG - Intergenic
1200076941 X:153555960-153555982 CCTGCAGATCTGATGGAGGAAGG + Intronic
1200121120 X:153791064-153791086 TCTGAAGAGCGGAAGGAGGCAGG - Intronic
1201690070 Y:16753324-16753346 CCCAAAGAGCAGAAGCAGGGTGG - Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1202111028 Y:21420861-21420883 CCTGAAGAGAAAAATGAGCAAGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic