ID: 1155553734

View in Genome Browser
Species Human (GRCh38)
Location 18:26995007-26995029
Sequence TCACTTCTGGGGAAAGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155553729_1155553734 -6 Left 1155553729 18:26994990-26995012 CCTCTCTCTTTGAGTGCTCACTT 0: 1
1: 0
2: 1
3: 26
4: 224
Right 1155553734 18:26995007-26995029 TCACTTCTGGGGAAAGCCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 124
1155553728_1155553734 6 Left 1155553728 18:26994978-26995000 CCATCTTGGGTGCCTCTCTCTTT 0: 1
1: 0
2: 2
3: 57
4: 544
Right 1155553734 18:26995007-26995029 TCACTTCTGGGGAAAGCCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155553734 Original CRISPR TCACTTCTGGGGAAAGCCGG TGG Intronic
900586621 1:3435704-3435726 TCACCGCTGGGGACAGCCTGAGG - Exonic
901206867 1:7502578-7502600 CTCCTTCTTGGGAAAGCCGGGGG - Intronic
905300791 1:36985117-36985139 TCAGTTCTGGGGCAGGCCAGAGG + Intronic
905565498 1:38961179-38961201 TGACTTCTGGGGAAGGAAGGGGG + Intergenic
905840143 1:41169714-41169736 TCCCTTCTGGGGAAAAACAGGGG + Intronic
906476244 1:46171470-46171492 TCACCTCTGGGGAAGGCTGCAGG - Intronic
909044636 1:70694804-70694826 TTACTTCTGGGGAAAGATGAGGG + Intergenic
910917578 1:92306979-92307001 TTACTTCTGGGGAATGCGGAGGG + Intronic
915086681 1:153394068-153394090 GCACATCTGGGGAAAGGCAGAGG + Intergenic
917783608 1:178427654-178427676 TCACTATTGGGGAAAGCTGGGGG - Intronic
919636307 1:200006766-200006788 TCCCTTCTGGGGAAAACAGGAGG - Intergenic
1062835034 10:629737-629759 TCACTGCTGGGCACAGCCTGAGG + Intronic
1067308741 10:45092450-45092472 TTACTTCTGGAGAAGGCCTGTGG - Intergenic
1074381600 10:112985199-112985221 TCACTTCTAGGGAAGGCAAGTGG + Intronic
1076572634 10:131442605-131442627 TCACTTCTGGGGAAGGGAGACGG - Intergenic
1076572688 10:131442921-131442943 TCACTTCTGGGCCAGGGCGGTGG - Intergenic
1077361152 11:2140611-2140633 TCATTTGTGGGGAAAGCGGCTGG - Intronic
1077377483 11:2211849-2211871 TCACTTCTGGGGATAGACCTGGG - Intergenic
1080589834 11:33712611-33712633 TCACTGCTGGGGCATGCAGGAGG + Intronic
1087236734 11:95727695-95727717 TCAATCCTGGGGAAAGCAGGGGG + Intergenic
1092383180 12:8015037-8015059 TCTCATCTGGGGAAAGACTGTGG - Intergenic
1094354853 12:29566389-29566411 TCACTTACGGGGAAAGTGGGCGG - Intronic
1095895124 12:47272384-47272406 TCGTTTCTAGGGAAAGCCAGTGG + Intergenic
1096914877 12:55020400-55020422 TCTCTTCTGGGTAAGGCAGGAGG + Intronic
1098364602 12:69689271-69689293 TCTCTGCTGGGGAAAGCAGCAGG + Intronic
1098571801 12:71996235-71996257 TCACTTGTGGAGGAAGCCAGTGG - Intronic
1099020626 12:77399618-77399640 ACACATCTCGGGAAAGCCTGAGG - Intergenic
1103457775 12:121079911-121079933 TCAGCCTTGGGGAAAGCCGGTGG - Intergenic
1103982840 12:124747754-124747776 TTACTTCTGGGGAGAGTCTGGGG - Intergenic
1106470841 13:30052743-30052765 TCACTACTGGGCAAGGTCGGGGG + Intergenic
1108035768 13:46289337-46289359 TCACTTGTGGGGTGAGGCGGGGG + Intergenic
1115516389 14:34189434-34189456 TGAATTCTGGGGAGAGCAGGAGG - Intronic
1121467768 14:94127076-94127098 TTACTTCTGGTGAAAGCCTCAGG - Intergenic
1122721420 14:103724549-103724571 TCCCTTCTGGGGGAAGGAGGGGG - Intronic
1125796408 15:42407083-42407105 GCACCTGTAGGGAAAGCCGGGGG - Intronic
1127655403 15:61050980-61051002 TCACCTCTGGGGAAATGCAGAGG - Intronic
1127852950 15:62930505-62930527 TCACTATTGGGGAAAACTGGGGG - Intergenic
1129391937 15:75225048-75225070 TGAGTTCTGGGGAAAGTCAGTGG + Intergenic
1131075517 15:89492851-89492873 TCCCTTCTGGGGAAGCCCAGTGG + Intronic
1131379816 15:91954545-91954567 TCACTTCTCAGGAAAGCCTGCGG - Intronic
1136544150 16:30946632-30946654 TCACTTATGTGGGAAGCAGGTGG + Intronic
1136605411 16:31330291-31330313 GCAGTTCTGGGGAACGCAGGAGG - Exonic
1139585311 16:67899100-67899122 CCATTTCTGGGGAAAGCTAGGGG - Intronic
1141883784 16:86878331-86878353 TGACTTGTGGGGAACGCAGGCGG - Intergenic
1142220913 16:88854515-88854537 TCCCTTCTGGGGTAGGCCCGAGG + Intronic
1142983078 17:3682491-3682513 TCACATCTGGGAAATGCCGCAGG + Intronic
1143356192 17:6330592-6330614 TGACTTCTGGGGGAAGCCAGGGG - Intergenic
1143527276 17:7479759-7479781 TCAGTCCTGGGGAAGGCCGTCGG - Intronic
1143923133 17:10346860-10346882 ACACTTCTGGGAGAAGCCAGGGG - Intronic
1148906765 17:50917308-50917330 TCCCTCCTGGGGAAATCCTGGGG - Intergenic
1150749983 17:67852371-67852393 TTGCTTCTGGGGAGAGTCGGGGG - Intronic
1151624351 17:75267412-75267434 TCACTTCTGGGGCAGGACTGTGG - Intronic
1151829033 17:76538773-76538795 TCAGTCCTGGGGACAGCCTGAGG + Intronic
1152073266 17:78144535-78144557 TCACTTCTGCTGAAGGCGGGTGG - Intergenic
1152088114 17:78232374-78232396 TCAGTTTTGGGGGAAGACGGAGG - Intronic
1153413882 18:4824245-4824267 TCACACCTGGGCAAAGCCTGGGG - Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155553734 18:26995007-26995029 TCACTTCTGGGGAAAGCCGGTGG + Intronic
1157564164 18:48668502-48668524 ACAGTTGTGGGGACAGCCGGGGG + Intronic
1160947002 19:1648333-1648355 CCACCTCTGGGTAAAGCCCGAGG + Intronic
1162911493 19:13850294-13850316 CCACTTCTGGGGAGCCCCGGTGG + Intergenic
1164602971 19:29576006-29576028 CCACTTCTGGTGACAGCCGCTGG - Intergenic
926922347 2:17951595-17951617 TCACTTCTGGGGGAATCGAGCGG + Intronic
930028245 2:47042951-47042973 TGACTCCTGGGGGAAGCTGGGGG - Intronic
935493081 2:103744654-103744676 CCACTCCTGGGGTAAGCCTGAGG + Intergenic
937233602 2:120417026-120417048 TTACTTCTGGGGAGAGAGGGAGG - Intergenic
937356723 2:121202478-121202500 CCACTGCTGGGGCAAGCTGGGGG + Intergenic
947138796 2:227001567-227001589 TCACGAATGGGGAAAGCCGCTGG + Intergenic
1170195095 20:13681344-13681366 TTAGTTCTGGGGAAAGTGGGTGG - Intergenic
1170851103 20:20005231-20005253 TCACTGCTGGGGAACGGGGGTGG + Intergenic
1171306611 20:24112461-24112483 CCACTACAGAGGAAAGCCGGGGG + Intergenic
1171478894 20:25437214-25437236 TCACTTCAGTGGAATGCGGGAGG + Intronic
1179446276 21:41433120-41433142 CCACTTCTGGGGATAGACTGTGG + Intronic
1180087814 21:45515915-45515937 TGTCTTCTGGGGAAAGCGGCGGG + Exonic
1181991194 22:26838292-26838314 CAACTTCTGGGCAAAGCTGGTGG + Intergenic
950443417 3:13022744-13022766 TCACTCCTAGAGAAAGCCTGGGG + Intronic
953526326 3:43692610-43692632 TCACTTCTGGGGATAGTCACTGG - Intronic
954716383 3:52528923-52528945 TCCCTTCTGGGTACTGCCGGGGG + Exonic
959424904 3:106175412-106175434 TCACTTCTAGGGAATGCTGAAGG - Intergenic
961636191 3:128334731-128334753 GCACTTCTGGGGAAGGAGGGAGG - Intronic
963290235 3:143479776-143479798 TCACTGCTGAGGACAGCCTGAGG - Intronic
965037056 3:163452574-163452596 TCACTTCTAGGGAATCCTGGGGG - Intergenic
965547955 3:169934555-169934577 TCACTTCTGGGGGACGGCAGAGG - Intronic
965687025 3:171315043-171315065 TCACTTCAGGATAAAGCAGGAGG - Intronic
966950035 3:184808111-184808133 TCACTCTTGGGGAGAGCTGGAGG + Intergenic
968584173 4:1408231-1408253 TCACCTCTGGGGAAGGAGGGTGG + Intergenic
968644769 4:1735000-1735022 AAACATCTGGGGAAAGGCGGGGG - Intronic
978963480 4:114712876-114712898 TTACTTCTGGAGAAAGCTTGAGG - Intergenic
982035784 4:151344391-151344413 CCACTTCTGGGGAAATCAGTGGG + Intergenic
988584262 5:32495145-32495167 TCACTCCTGGGGAAAGCACTGGG + Intergenic
991495244 5:67219851-67219873 GCACTTCTGGTGAAAGCATGTGG + Intergenic
993754713 5:91714248-91714270 TGGCTTCTGGGGAAAGCCTCAGG + Intergenic
997609119 5:135199791-135199813 TACCTTCTGGGGAATGGCGGAGG - Intronic
998058525 5:139100247-139100269 TCACTTCTGAGGAAAGACTAAGG + Intronic
999073496 5:148772777-148772799 TCCCTTCTGGGAACACCCGGAGG - Intergenic
999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG + Intronic
1000667161 5:164012931-164012953 TCACCTCTGGGGCAAGGAGGTGG + Intergenic
1000900361 5:166904888-166904910 TCCCTTCTGGGGATAACCTGTGG + Intergenic
1001785920 5:174413008-174413030 CCAATTTGGGGGAAAGCCGGGGG + Intergenic
1002053380 5:176584552-176584574 TCACGTCCGGGGGCAGCCGGAGG - Exonic
1002139277 5:177128960-177128982 TCAATTTTGGGGAAATCCGTGGG + Intergenic
1002430486 5:179200680-179200702 TAACTTCTGGGGAGGGCAGGAGG + Intronic
1003026472 6:2559462-2559484 TCACCTCTGAGGCAAGCCTGAGG - Intergenic
1010265962 6:73867514-73867536 TCATTTCTGGGGAGAGGTGGAGG + Intergenic
1018698428 6:166408309-166408331 GCACTTCTGGGTACAGCAGGAGG + Intergenic
1019297277 7:284787-284809 TCCCTTCTGGGGCGAGCCGAGGG + Intergenic
1019447058 7:1076764-1076786 AGCCTTCTCGGGAAAGCCGGGGG + Intronic
1020131071 7:5558909-5558931 TCATTTCTGGGGAAGGCCCAGGG + Intronic
1020131082 7:5558939-5558961 TCATTTCTGGGGAAGGCCCAGGG + Intronic
1022037678 7:26549723-26549745 TAGCTTCTGGGCAAAGCCAGTGG + Intergenic
1029196616 7:98810047-98810069 TCACTGCTGTGGACAGCCGTGGG - Intergenic
1031423033 7:121572185-121572207 TAACATCTGGTGAAAGCAGGAGG + Intergenic
1032810292 7:135407161-135407183 TGGCTTCTGGGCAAAGCGGGAGG - Intronic
1033287857 7:140057895-140057917 TCACTTCTGGCAAAAGCCAGGGG + Exonic
1035216537 7:157371847-157371869 TTACATCTGGGAAAAGCCTGTGG + Intronic
1036503013 8:9330656-9330678 TCATTTCTGGGGGAAGCTGTAGG + Intergenic
1039237578 8:35519001-35519023 TTACTTCTGGAGAAAGCAAGAGG - Intronic
1039465708 8:37783894-37783916 TCACTCCTGGGGAAGGGGGGCGG - Intergenic
1039805309 8:40992608-40992630 TGGCTTCTGAGGAAAGCCCGTGG + Intergenic
1039936222 8:42048537-42048559 TAACTGCTGGTGAAAGCCAGAGG + Exonic
1040518327 8:48152811-48152833 TCTCTGGTGGGGAAAGCTGGAGG + Intergenic
1044819650 8:96147039-96147061 TAGCTTCTGGGGAAGGCTGGGGG - Intronic
1045518779 8:102884885-102884907 TGACTTCTGGGGATAGGTGGTGG + Intronic
1048134819 8:131738264-131738286 CCAATGCTGGGGAAAGCAGGAGG + Intergenic
1048962560 8:139593019-139593041 TCACTTCTGGGGGAAGCCATAGG - Intergenic
1049226191 8:141451668-141451690 TCACTGCAGGTGAGAGCCGGTGG + Intergenic
1051944612 9:22552674-22552696 GCAATTCTGGGGAAAGTCAGTGG + Intergenic
1053543420 9:38998118-38998140 TCACTTCAGGGGAAAAGCAGGGG - Intergenic
1057209343 9:93191197-93191219 TCATTTCCGGGGACAGCTGGGGG + Intronic
1058341642 9:103904626-103904648 CCACTTCTGGTGAAAGCCTCAGG - Intergenic
1060257759 9:122047516-122047538 TCTCTTCTGGGGAGAGGGGGTGG - Intronic
1187388923 X:18873150-18873172 TCCCTTTTGGGGAAAGCCTGAGG - Intergenic
1189774369 X:44456968-44456990 ACACTTCTGGGGAAAGCCCTTGG - Intergenic
1191788789 X:64946064-64946086 TCACTCCTCTGGAAAGGCGGTGG - Intronic