ID: 1155553921

View in Genome Browser
Species Human (GRCh38)
Location 18:26996732-26996754
Sequence ACATACATGCACACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155553921 Original CRISPR ACATACATGCACACTGTGGA GGG (reversed) Intronic
900598251 1:3492274-3492296 GCGTCCATCCACACTGTGGATGG + Intronic
901239421 1:7684305-7684327 ATAGTCATGCACACTCTGGAAGG - Intronic
901260552 1:7867467-7867489 ACACACATGCACACGGAGAAAGG + Intergenic
901710525 1:11111080-11111102 TCATACATGGACACTGTGACAGG - Intronic
901817389 1:11802683-11802705 AAATACCTTGACACTGTGGAGGG + Intronic
905997540 1:42394359-42394381 ACATGCATGCACAGGTTGGAGGG + Intronic
911654281 1:100425180-100425202 ACATACATACATACAGTAGAAGG + Intronic
912583810 1:110743444-110743466 ATATTCAGGAACACTGTGGATGG + Intergenic
914811120 1:151028976-151028998 ACATACAGGCAGACTCTGTAAGG - Intronic
915102345 1:153509487-153509509 ACATACTTTCACATTGTGGAGGG - Intergenic
916063998 1:161121432-161121454 ACACACATACACAGGGTGGATGG - Exonic
916310611 1:163394859-163394881 AGATACATACACATTGTGGTAGG + Intergenic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
917089324 1:171336979-171337001 ACACACACGTACAATGTGGAGGG + Intronic
917106392 1:171496630-171496652 ACACACATGCACTCTGTGCTTGG + Intronic
917681472 1:177372466-177372488 ACAAACAAGCACACTGTAAAAGG - Intergenic
917985726 1:180316352-180316374 ACATACATGCAAACTCCTGATGG + Intronic
919373094 1:196755887-196755909 ACACACTTGCACATTGTTGATGG + Intergenic
919379539 1:196840570-196840592 ACACACTTGCACATTGTTGATGG + Intronic
919506400 1:198403712-198403734 ATATATCTGCACAGTGTGGAAGG - Intergenic
919824672 1:201494813-201494835 ACACACACGCACACTGCTGAGGG - Intronic
920649318 1:207824958-207824980 CCATGCATGAACATTGTGGAGGG - Intergenic
921704680 1:218308793-218308815 AAATACATGAACACTGTGTTTGG + Intronic
1065291876 10:24238619-24238641 ACACACATACACACTCTGGCAGG + Intronic
1067333617 10:45343919-45343941 ACATACATGCACCCAGTACAGGG + Intergenic
1070505488 10:77109350-77109372 ACATACATGAAAGCTGTGTATGG + Intronic
1071906484 10:90179999-90180021 GCATCCATGCAGACTGTGGAAGG - Intergenic
1073562191 10:104506496-104506518 AGATCCATGCACACAGTAGAAGG + Intergenic
1073566178 10:104537515-104537537 AAATAGGTCCACACTGTGGAAGG - Intergenic
1073788213 10:106913317-106913339 ACATTGATGAACACTGTGGCTGG + Intronic
1074581315 10:114721961-114721983 ACATACATGCACACATTTTAAGG - Intergenic
1074731061 10:116376118-116376140 TCATTGATGGACACTGTGGATGG - Intronic
1075575951 10:123577667-123577689 ACACACATGCACACACAGGAAGG + Intergenic
1075579805 10:123608758-123608780 ACATAAATGCACAGAATGGAAGG - Intergenic
1076456864 10:130606138-130606160 ACATATTTGCACACGGTGCATGG - Intergenic
1079005590 11:16789395-16789417 ACACACATGCACACTCTAGTTGG + Intronic
1081625376 11:44652193-44652215 CCAAACAGGCAGACTGTGGAAGG + Intergenic
1083018981 11:59486841-59486863 ACATACAGGCACATTTTGGTTGG - Intergenic
1084497400 11:69513081-69513103 ACATACTTGCACTCTCAGGAAGG - Intergenic
1085122463 11:73975918-73975940 ACAGGCATGCACACTGTGCCTGG - Intronic
1085882215 11:80480958-80480980 ACACACACACACACTGTGCACGG + Intergenic
1086853172 11:91835563-91835585 TCATACATGCAAACTGAGAATGG - Intergenic
1088273741 11:108062377-108062399 ATAAACAAGCACACTGTTGATGG - Intronic
1089171204 11:116512812-116512834 ACATGCATGCACATTTTGGTGGG + Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096011038 12:48215152-48215174 GAATACATGCACACTGTTGGTGG - Intergenic
1097178916 12:57159821-57159843 ACAGGCATCCACAATGTGGAGGG + Exonic
1097743842 12:63277339-63277361 ACATACATGGACCATGAGGAGGG + Intergenic
1100051678 12:90456855-90456877 ACACATATGCACACAATGGATGG - Intergenic
1101565239 12:105898712-105898734 TCATTCATGCACAGTCTGGAAGG + Intergenic
1101697992 12:107144738-107144760 ACAAACATGCAATATGTGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106024629 13:25945211-25945233 ACATACATACACACTGCTGGGGG - Intronic
1106095658 13:26640895-26640917 ACAAATATGAACACTGGGGAGGG - Intronic
1107365800 13:39673785-39673807 ACACACATACTCACTCTGGAAGG - Intronic
1108592174 13:51921897-51921919 ACACACACGCACACAGTGGGTGG - Intergenic
1108647654 13:52446719-52446741 ATATACATACACACTCTGGCTGG - Intronic
1108687022 13:52828529-52828551 AAATAGATGCAAACAGTGGAGGG - Intergenic
1110485366 13:76034922-76034944 ACATACATGCATACAATGGAAGG + Intergenic
1111850748 13:93571265-93571287 ACATACATGCACACTACTTAAGG + Intronic
1114164338 14:20204080-20204102 AACTACATGAAAACTGTGGATGG + Intergenic
1114714656 14:24812447-24812469 ACACACATACACACAGTGGGAGG + Exonic
1115027853 14:28764791-28764813 AGATACATACATACAGTGGAAGG + Intergenic
1118449130 14:65881637-65881659 ACATACATACACACTGTTGCTGG - Intergenic
1118573941 14:67222804-67222826 ACATAAAAGAACACTATGGAAGG + Intronic
1118912697 14:70075108-70075130 ACACACATACACACAGTTGAAGG - Intronic
1120818988 14:88894611-88894633 ACATACAGACACACAGGGGAGGG - Intergenic
1125323446 15:38512586-38512608 CCATACAAGGACAGTGTGGAGGG - Intronic
1125445745 15:39754132-39754154 ACATACACGCATCCTATGGAGGG + Intronic
1128711745 15:69877319-69877341 ACATCCATGCACACTGTCAGTGG - Intergenic
1130155853 15:81349388-81349410 ACTTACATTCCCACTGTGGGTGG + Intronic
1131280820 15:91019707-91019729 ACATGCTTGCGCTCTGTGGATGG - Intronic
1132088657 15:98928896-98928918 ACACACATGCACACACTGGACGG - Intronic
1133193901 16:4154715-4154737 ACAGACCTGCTCACGGTGGAGGG + Intergenic
1138383184 16:56617746-56617768 ACATAGAGGCACAGTGAGGAGGG - Intergenic
1139241170 16:65393777-65393799 ACACACATACACACTATGGGAGG - Intergenic
1139951397 16:70673403-70673425 AAATACCTTCACAGTGTGGATGG + Intronic
1140816830 16:78628896-78628918 AGATAAATGCACAATGAGGAGGG - Intronic
1141684121 16:85560689-85560711 ACATACATACATACAGAGGAAGG - Intergenic
1142009971 16:87708976-87708998 ACAAACAAGCATGCTGTGGACGG + Intronic
1150112610 17:62515431-62515453 GAATACTTGCACACTGTTGATGG - Intronic
1150919121 17:69465008-69465030 AAATAAATGCACAGTCTGGATGG - Intronic
1155553921 18:26996732-26996754 ACATACATGCACACTGTGGAGGG - Intronic
1155743573 18:29321466-29321488 ACATACACACACACACTGGAAGG + Intergenic
1157312640 18:46563546-46563568 ACAAACATGCAAACTGTAGCAGG - Intronic
1158885276 18:61820978-61821000 ACATACTTCCACACAGTGAAAGG + Intronic
1159439421 18:68458074-68458096 ACATACATGCATACTCTGGATGG + Intergenic
1161707782 19:5830091-5830113 ACACACATGCACACTGTGGCAGG - Intergenic
925424207 2:3735301-3735323 ACAAACCTGCACATTGTGCACGG - Intronic
926276928 2:11411043-11411065 ACAAACATGGACCCTGAGGAAGG + Intergenic
926788816 2:16548704-16548726 ACACACATGCACACTCTTCAAGG + Intergenic
926987756 2:18641981-18642003 ACATGCAAACACACTGTGGAGGG + Intergenic
929438084 2:41943930-41943952 AAAGACATGCACATTGTAGATGG - Intronic
929836283 2:45403410-45403432 ACATAAAAGAACACTGAGGAAGG - Intronic
929894710 2:45949113-45949135 ATATACATGTATACTGAGGAAGG + Intronic
930475905 2:51881763-51881785 ACACACATGAACTCAGTGGAGGG - Intergenic
930851187 2:55962341-55962363 ACATATAAGCAAACTGTGTAAGG - Intergenic
931786278 2:65622033-65622055 ACATAAAGGCAAAGTGTGGAGGG + Intergenic
932682362 2:73836793-73836815 AGGTGCATGCACACTGGGGAGGG + Intronic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
935040056 2:99417438-99417460 AAATACAGTCACACTGTGGCCGG - Intronic
940699766 2:157026204-157026226 GAATACATGCACACTGGTGATGG + Intergenic
942638166 2:178031773-178031795 ACACACATGCACACTCTGATAGG - Intronic
943859798 2:192847263-192847285 ATTTACATGCTCACTGTGAATGG + Intergenic
943882322 2:193161904-193161926 ACACACATACACACCCTGGAGGG - Intergenic
944997445 2:205309988-205310010 ATATATATACACAATGTGGAAGG + Intronic
946680334 2:222207952-222207974 ACATATATACACACTTTAGAGGG - Intronic
946912568 2:224479695-224479717 ACATACACACACACAGAGGAAGG + Intronic
947745030 2:232503074-232503096 ACAAACACGCACTCTGCGGAAGG + Intergenic
947908057 2:233780144-233780166 ACATCCCTGCACACTGTGTCTGG - Intronic
948058075 2:235024300-235024322 CCATGCATGCAAACTGTGGATGG - Intronic
1170960058 20:21017654-21017676 TCATATATGCACACTGGGGCAGG - Intergenic
1171252455 20:23659403-23659425 ACATACATACACACTGTATTAGG + Intergenic
1174177611 20:48655024-48655046 AAATACATGTTCACTCTGGAAGG - Intronic
1176840613 21:13839822-13839844 ACATGAATCCACACTCTGGAGGG + Intergenic
1178500610 21:33123078-33123100 ACATAAATTCTCACTGTTGAAGG + Intergenic
1179606602 21:42519949-42519971 ACACACAAACACACTGTGGAGGG - Intronic
1182862908 22:33576140-33576162 ACATAAATACATACTGTGCACGG - Intronic
1184035921 22:41918050-41918072 ACACACATGCCCACCGTGCAGGG - Intergenic
949220166 3:1623359-1623381 ACACACACACACACTCTGGATGG - Intergenic
952088856 3:29859902-29859924 ACACACATACACACTCTGGTAGG + Intronic
956211419 3:66805310-66805332 ACACCCATTCACACTGGGGAGGG + Intergenic
957666098 3:83230417-83230439 ACATGCATGAAAACTGTGCAGGG + Intergenic
959277965 3:104301541-104301563 AAATTCTTACACACTGTGGATGG - Intergenic
959616829 3:108358141-108358163 ACCTACATGCACTGTGTGGATGG - Exonic
960928279 3:122817883-122817905 AGATACATGCACACTGGGCAAGG - Intronic
961378999 3:126485183-126485205 ACATACATGAATAGTGTAGAAGG + Intronic
962256671 3:133875377-133875399 ACATACAAGCACAGGGTAGAAGG + Intronic
963194165 3:142507746-142507768 ACACACATGTACCCTGAGGAAGG - Intronic
963397374 3:144750818-144750840 ACAACCTTCCACACTGTGGAAGG - Intergenic
964352765 3:155819539-155819561 AGATGAATGCACACAGTGGAAGG + Intergenic
964428350 3:156577014-156577036 ACATACATTCATACTGGGAATGG + Intergenic
965346777 3:167560819-167560841 ATCTACATGCACACTTTGAAAGG + Intronic
966589322 3:181663145-181663167 ACATACATACACACAGTGAATGG + Intergenic
966903797 3:184507577-184507599 GCATACAAGCACTTTGTGGATGG + Intronic
967301615 3:188019963-188019985 AAATAAATACACACTGTGGGAGG - Intergenic
970087024 4:12360891-12360913 AAACACATGAACACTGTTGATGG + Intergenic
970252906 4:14135253-14135275 ACATACAGACACAATGAGGAAGG - Intergenic
970935221 4:21561865-21561887 TCATAAATGAACAATGTGGAAGG - Intronic
971188754 4:24406663-24406685 ATACACATGCCCACAGTGGAAGG + Intergenic
971732444 4:30402851-30402873 ACATAAATGCAGACTGTACATGG + Intergenic
972399146 4:38684428-38684450 AAGTAAATGCACACTGTGCAGGG + Intronic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
975392900 4:73840096-73840118 ACATACATTCACACTGCAGCTGG + Intronic
975482279 4:74894163-74894185 AAATACAAGGACACTGTAGAGGG + Intergenic
979143591 4:117211271-117211293 ACACACACACACACTGTGAAAGG + Intergenic
979428088 4:120592788-120592810 ATATACAGGGATACTGTGGATGG + Intergenic
980845452 4:138318823-138318845 AAATACATGCACACTGATTATGG + Intergenic
981119288 4:141030331-141030353 AAAAACATGTACACTGTTGATGG + Intronic
981738359 4:147976473-147976495 ACATTCATGAAAACTGGGGATGG - Intronic
981740440 4:147996045-147996067 ACATACAGGCCCCCTGTGGAAGG - Intronic
983851028 4:172581268-172581290 GTATGCATGCACACTCTGGATGG - Intronic
984646040 4:182220741-182220763 ACATAAATGTACACTGTACATGG - Intronic
984711145 4:182886502-182886524 ACATGCATGGAAACTGTGGATGG + Intergenic
985362337 4:189189034-189189056 ACATGCATGCGCACTGTTGGGGG + Intergenic
985979705 5:3452302-3452324 ACATCCAGACACACTGTGCAGGG + Intergenic
987171928 5:15268261-15268283 AAATACATGCACACTTAGAATGG + Intergenic
987256237 5:16154893-16154915 TCATACCAGCACACTGTTGATGG + Intronic
987455835 5:18145481-18145503 ACAGACATGGACACTGTTGATGG - Intergenic
989421142 5:41240849-41240871 ATACCCATGCACACTATGGAGGG - Intronic
990646919 5:57855719-57855741 ACAGGCATGCACACTGTGCCTGG + Intergenic
990695331 5:58409901-58409923 ACATTCATACACAGTGTGAAGGG - Intergenic
992794486 5:80243488-80243510 ACACAGATGCACACTGAAGAGGG + Intronic
993623995 5:90201655-90201677 ACATACATGGACAGAGGGGAGGG + Intergenic
994962133 5:106618988-106619010 ACATCCATCCCCACTGTAGAAGG - Intergenic
996467453 5:123820309-123820331 ACATACATTCATACCGTAGAGGG - Intergenic
998889090 5:146727385-146727407 ATATACATTTACATTGTGGATGG + Intronic
999676415 5:154007788-154007810 AAATAAATGCTCACTGTTGATGG - Intronic
999842121 5:155439037-155439059 AGATAAAAGCACACTGTGGTGGG - Intergenic
999990945 5:157049267-157049289 CCCTGCATGCCCACTGTGGAAGG - Intronic
1000020104 5:157311157-157311179 ACATGGAAGCACACTGTGGTGGG - Intronic
1000039852 5:157477501-157477523 ACATACAAACGCACAGTGGACGG + Exonic
1000130398 5:158291551-158291573 CCATTCATGCACACGGTGAAGGG - Intergenic
1000491583 5:161921193-161921215 ACATTCATGCCCAATCTGGAAGG - Intergenic
1000740117 5:164958614-164958636 GCATACATACATACTATGGAAGG - Intergenic
1000821511 5:165990297-165990319 GTCTACATGCACACTGAGGAAGG + Intergenic
1001472267 5:172022829-172022851 ACATACATGGAGACTGCTGAAGG - Intergenic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1006250700 6:32781238-32781260 ACAAATATCCAAACTGTGGATGG - Intergenic
1007510608 6:42371775-42371797 ATATACAAGCACAATGTGGGGGG - Intronic
1007608107 6:43130701-43130723 ACACACATGCATTCTGTAGAAGG + Intronic
1007946462 6:45831607-45831629 ACACACACACACACTGTGGGAGG - Intergenic
1008293538 6:49749468-49749490 ACACACATGTACAGTTTGGAGGG - Intergenic
1010621986 6:78088120-78088142 AGAAATATGCACATTGTGGATGG + Intergenic
1011476701 6:87755628-87755650 ACATACATACATATTGTAGAAGG - Intergenic
1011539928 6:88418365-88418387 AGATACATGCACTCTCTGGCTGG + Intergenic
1013795454 6:113883072-113883094 ACACACCTACACACTGTGTAGGG - Intergenic
1014356132 6:120412380-120412402 AAATGCATACACACTGTTGATGG + Intergenic
1014694517 6:124602524-124602546 AAATAAATGCAAATTGTGGATGG + Intronic
1016830292 6:148426987-148427009 ATATACATGCTCAGTGTGGGTGG + Intronic
1017753811 6:157512498-157512520 ACACACATGCACACTTTGTTGGG + Intronic
1019099921 6:169621908-169621930 ACACATATACACACTGTGAAAGG + Intronic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1022419404 7:30206394-30206416 CCATTCATGCACACTATGGCAGG + Intergenic
1022436375 7:30389811-30389833 GCATACATGCACACTCCGGATGG - Intronic
1027413036 7:77942954-77942976 GCATACATGCTCACTGTTCATGG - Intronic
1027440779 7:78217003-78217025 ACAGACATGCACACAGGGGATGG + Intronic
1027767106 7:82358222-82358244 AACTACAGGAACACTGTGGATGG - Intronic
1028111479 7:86947760-86947782 ACATTCATGGACACTGTGGTGGG - Exonic
1028224269 7:88231827-88231849 AAACACCTGCACACTGTTGATGG + Intergenic
1029076276 7:97936745-97936767 ACAAACTTCCACAGTGTGGAAGG - Intergenic
1030597361 7:111556001-111556023 ATATACATGCACACAGAAGAGGG - Intronic
1031016842 7:116584793-116584815 AGAAACATCCACACTTTGGATGG - Intergenic
1032184101 7:129708742-129708764 ACATGCATGAAAACTGTAGAAGG + Intronic
1034870488 7:154679159-154679181 CCACACAGGTACACTGTGGATGG - Intronic
1035283130 7:157789604-157789626 ACATACACACACACTGTCAAAGG - Intronic
1035390319 7:158499828-158499850 ACACACATACACACACTGGAGGG - Intronic
1035461164 7:159040106-159040128 CCAAACAAGCACACTGAGGAAGG + Intronic
1038812363 8:30862037-30862059 GCATTCTTACACACTGTGGATGG + Intronic
1041279548 8:56196937-56196959 ACACACACGCACACTAGGGAGGG - Intronic
1041684664 8:60632357-60632379 ACACACATGCACAATGTCTATGG - Intergenic
1043706252 8:83354856-83354878 AAATAAATGCACACTATGCAGGG - Intergenic
1044334818 8:90968678-90968700 ATATATATGCACACACTGGAAGG + Intronic
1045255793 8:100519792-100519814 AGCTACAGGCGCACTGTGGAAGG + Intronic
1049602524 8:143514502-143514524 ACTGACATGCACACGGTGGGCGG + Intronic
1049632649 8:143666925-143666947 ATGTACATGCACACGGAGGAGGG - Intergenic
1049756867 8:144314654-144314676 AGATATATACACACAGTGGATGG + Exonic
1050162928 9:2736578-2736600 ACAGAAGAGCACACTGTGGATGG - Intronic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1050967309 9:11821954-11821976 ACACACATGCACACTATAAAAGG - Intergenic
1051082475 9:13309284-13309306 GCACATATGCACACTGTGAATGG + Intergenic
1051774778 9:20621894-20621916 ACACACACACACACGGTGGAAGG - Intronic
1052997535 9:34559224-34559246 AGTCACGTGCACACTGTGGATGG - Intronic
1053352425 9:37422529-37422551 ACACACAAGGACACTGTGTAGGG + Intergenic
1057514429 9:95709511-95709533 TGATATATGCCCACTGTGGAAGG - Intergenic
1059221352 9:112623159-112623181 ACCTACATGAACACAGTGGATGG - Intronic
1059238219 9:112780309-112780331 AAATACATTCACAATGTTGAAGG - Intronic
1060032899 9:120231001-120231023 ACCCACAGGCACAGTGTGGATGG - Intergenic
1061094230 9:128445286-128445308 ACATACATCCAGACTGTAGCGGG - Intergenic
1061300445 9:129701680-129701702 ATATTCATGCACACTGTAAATGG + Intronic
1062553511 9:137101883-137101905 ACACACATTCACACTGTTGCAGG + Intronic
1062553598 9:137102830-137102852 ACACACATTCACACTGTTGCAGG + Intronic
1062553632 9:137103180-137103202 ACACACATTCACACTGTTGCAGG + Intronic
1062553682 9:137103684-137103706 ACACACATTCACACTGTTGCAGG + Intronic
1062553693 9:137103799-137103821 ACACACATTCACACTGTTGCAGG + Intronic
1186002258 X:5026086-5026108 ACATTCATGCACATTGCGGTAGG + Intergenic
1186365284 X:8886081-8886103 ACACACACACACACTGTGGCAGG - Intergenic
1195916956 X:109945301-109945323 ACACACACACACACAGTGGATGG + Intergenic
1196481382 X:116153874-116153896 ACATGCATGCAAAATGGGGAAGG - Intergenic
1196646147 X:118119070-118119092 ACATATATGCACATAGAGGAAGG + Intergenic
1197573867 X:128183381-128183403 ACATACATGCACATATTGTATGG + Intergenic
1198654143 X:138895263-138895285 ACATACATGGTAACTGTGGATGG - Intronic
1199426827 X:147712069-147712091 AAAAACTTGCACACTGTTGATGG - Intergenic
1200780304 Y:7209456-7209478 ACATACATGCACACTGGCACTGG + Intergenic