ID: 1155555161

View in Genome Browser
Species Human (GRCh38)
Location 18:27010872-27010894
Sequence CTGTCTCAAGGGCAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155555153_1155555161 22 Left 1155555153 18:27010827-27010849 CCAGCTGCAGAAGCTATAGTCAC 0: 1
1: 0
2: 2
3: 12
4: 126
Right 1155555161 18:27010872-27010894 CTGTCTCAAGGGCAGATGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155555161 Original CRISPR CTGTCTCAAGGGCAGATGGG TGG Intronic
900119263 1:1041626-1041648 CTGTGTCATGGGCCGATCGGGGG + Exonic
900192740 1:1358363-1358385 CTGGCCCAAGCTCAGATGGGCGG + Intronic
900914776 1:5628883-5628905 CTTTCTCAAGTTCAGATTGGTGG - Intergenic
901204632 1:7487003-7487025 CTGACTCAAGGGTTGTTGGGAGG + Intronic
901458174 1:9375889-9375911 CTGTCTCAGTGAAAGATGGGGGG - Intergenic
901778131 1:11574720-11574742 CTGTCTCAAAAAAAGATGGGGGG + Intergenic
902436769 1:16403142-16403164 GTGTCTCCAGGGCAGGTGGGTGG - Intronic
902482935 1:16721062-16721084 CTCCCTCAAGGGCAGCTGAGAGG + Intergenic
902925679 1:19694354-19694376 CTGTCTCCAGGGGACAGGGGTGG + Intronic
902985640 1:20152562-20152584 CTGGGTCCAGGGCAGAGGGGCGG - Intergenic
903012793 1:20343089-20343111 CTGTCTCGAAGGCAGAGGGATGG - Exonic
903225976 1:21894454-21894476 CTGCCCCAAGGGCAGCTGGCAGG + Intronic
904684682 1:32251497-32251519 CTCGCTCAAGGTCAGGTGGGAGG + Intronic
909134973 1:71786658-71786680 CTATCACAAAAGCAGATGGGTGG - Intronic
912548606 1:110469040-110469062 CTGTCACAAGGGCAGAGCAGGGG + Intergenic
912572126 1:110632394-110632416 CTGGCTCAAAGGCAGCTGAGAGG + Intergenic
918931810 1:190864402-190864424 CTGCCTCAAGGCCAGTTTGGTGG - Intergenic
919832662 1:201552887-201552909 CTGTCTGAGGGTCAGATGGACGG + Intergenic
921195388 1:212751945-212751967 CTGTCTCACATGCAGATGGCTGG + Intronic
922221345 1:223610764-223610786 CTATGTCAAGGGCAGATGTGGGG - Intronic
922709413 1:227815872-227815894 CTGCCCCAGGGGCGGATGGGCGG + Intronic
922999392 1:229994226-229994248 CTGCCATAAGGGCAGCTGGGAGG + Intergenic
923777683 1:236994860-236994882 ATCTCTCAAGGCCCGATGGGAGG - Intergenic
923896553 1:238276386-238276408 CCTTCTCAAGGGCAGAGCGGGGG + Intergenic
924320461 1:242843442-242843464 TTGTCTCCAGGGGAGATGGTAGG + Intergenic
1062891020 10:1059961-1059983 CAGCCTCCAGGGTAGATGGGAGG + Intronic
1063101151 10:2951173-2951195 CTTTCTGAAGGGCGCATGGGAGG - Intergenic
1065600226 10:27360003-27360025 CTGTCCCAAGGCCAGATGCCAGG - Intergenic
1067435669 10:46274537-46274559 CTCTCTCTAGGGCAGAAGTGTGG + Intergenic
1068067156 10:52146057-52146079 CTGTCTCCAGTGCAGCTAGGAGG - Intronic
1069913001 10:71771241-71771263 CTGACTCAGGGTGAGATGGGTGG - Intronic
1071949371 10:90685071-90685093 CTGTAGCAAGGGCACATGAGGGG - Intergenic
1074528798 10:114282674-114282696 CTGGCTCCAGGGCAGAGGGATGG + Intronic
1074583384 10:114742945-114742967 CTACCTCAAGGACAGATGTGAGG + Intergenic
1076403739 10:130199243-130199265 CTGTATCAAAAGCAGATGGTGGG + Intergenic
1077141169 11:1025573-1025595 ATGTCTCCCGGGCAGAGGGGAGG - Intronic
1077219342 11:1408502-1408524 GTGTCTCCTGGGAAGATGGGGGG - Intronic
1077289463 11:1782255-1782277 CTGTGTCCAGGGCACAGGGGAGG - Intergenic
1077676255 11:4195497-4195519 CTGACTGAATGGAAGATGGGTGG - Intergenic
1079060500 11:17244625-17244647 CTTTCTCAAAGGAAGAAGGGTGG - Intronic
1079525316 11:21380025-21380047 CTGTGGCAAGGGCATCTGGGGGG + Intronic
1081993480 11:47349836-47349858 GTGGTTCAAGGGCAAATGGGTGG - Exonic
1082667604 11:55992932-55992954 CTGTCTCAAGGAAAGAGGGAGGG + Intergenic
1083511235 11:63211001-63211023 CTGTCCCAAGGGCTGAGGAGTGG + Intronic
1083697322 11:64451562-64451584 CTTTCTGCAGGGCAGATGTGGGG + Exonic
1084871421 11:72101046-72101068 CTGTCTGAAGTGGAGCTGGGAGG - Intronic
1086913192 11:92496653-92496675 CTGTCTCTAGGGCAGTGGTGGGG + Intronic
1087850679 11:103024808-103024830 CTGTCTCAAGGTCACGTGGCAGG + Intergenic
1090983045 11:131740293-131740315 CTGTCTCAAGGGGTGTTGTGAGG + Intronic
1091342577 11:134828790-134828812 GTGATTCAAGGGCAGAAGGGTGG - Intergenic
1093619596 12:21273280-21273302 CTCTCTCAAGGACAGAGGGCAGG - Intronic
1098876767 12:75873652-75873674 CTGTGGCAAGGGGAGTTGGGTGG + Intergenic
1100984453 12:100190875-100190897 CTTTCTCAAGGGCAGTTGTGAGG - Intergenic
1102760359 12:115379864-115379886 CTGTCTAAAGGGCAGGAAGGTGG - Intergenic
1103015722 12:117493068-117493090 CTGCCTCGTGAGCAGATGGGAGG + Intronic
1103713525 12:122929904-122929926 CAGTCACAAGGCCTGATGGGGGG - Exonic
1103934738 12:124469127-124469149 CTGGCCCAAGGTCAGATGGAAGG + Intronic
1104042463 12:125139418-125139440 ATGCCTCAGGGGCAGAGGGGGGG - Intronic
1104516936 12:129436069-129436091 CTGTCTGAAGTGCAGCTGTGAGG + Intronic
1104721550 12:131047384-131047406 AGCTCTGAAGGGCAGATGGGTGG + Intronic
1106313431 13:28573808-28573830 CTTGCTCACGGGCAGCTGGGAGG + Intergenic
1106482475 13:30147316-30147338 ATTTCTCAAGAGCAGAAGGGAGG - Intergenic
1106883799 13:34160498-34160520 TTGTCCCAATGGCAGATGAGGGG - Intergenic
1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG + Intergenic
1110915967 13:81021207-81021229 TTGTCCCAAGGGCAGGTTGGAGG - Intergenic
1112455797 13:99561855-99561877 CTGTCTCATGGTCACATGGATGG - Intronic
1112495229 13:99898765-99898787 TTGTCTCTAGGGGAGCTGGGAGG - Intergenic
1113887826 13:113670288-113670310 CTGTCTCAGCGGCAGATCCGGGG - Intronic
1117270201 14:54135828-54135850 CTGTGTCAAGGGTGGATGTGAGG - Intergenic
1117648899 14:57882025-57882047 CTGGATGAAGGGCATATGGGAGG - Intronic
1119604807 14:76006269-76006291 CTGTTTCAAGGGCAGGAGTGGGG + Intronic
1120543312 14:85778297-85778319 TTGTCACAAGGACAGGTGGGTGG + Intergenic
1120765188 14:88322367-88322389 TTGTCTCTCTGGCAGATGGGTGG - Intronic
1121680938 14:95792266-95792288 CTCTCTCAAGTGCTGCTGGGAGG + Intergenic
1122176667 14:99925890-99925912 CCATCTCTAGGGCAGTTGGGTGG - Intronic
1122262221 14:100530093-100530115 CTTCCTCAAGGGTAGATGAGAGG + Exonic
1124668492 15:31615887-31615909 CTGGCACAGGGGCAGATGGGAGG + Intronic
1125913530 15:43463766-43463788 CTCTCTCCAGGGCAGAGGAGGGG - Intronic
1125956727 15:43795529-43795551 CTCTCTCCAGGGCAAAGGGGTGG - Exonic
1128688667 15:69706675-69706697 CTGTCCCTAGGGCAGTTGGCTGG + Intergenic
1129119944 15:73390071-73390093 TTGTCCCATCGGCAGATGGGAGG - Intergenic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129411530 15:75353173-75353195 CTGTCTCATGGGCAGCTTGGAGG - Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1132291904 15:100709806-100709828 CTGTGTCTAGGCCAGATGGGAGG + Intergenic
1133032822 16:3019660-3019682 CAATCTCAAGGGGAGGTGGGGGG + Intronic
1133620391 16:7520453-7520475 CTATCTCCAAGGCAGATTGGTGG - Intronic
1133974682 16:10592053-10592075 CTTGCTCAAGGGCACATGGCAGG + Intergenic
1138582495 16:57950761-57950783 CTGTCTCAAGAGGAGAAGGGGGG - Intronic
1138835242 16:60426902-60426924 CAGTAGCAAGGACAGATGGGTGG - Intergenic
1139363603 16:66419247-66419269 CTGTCTCAAAAACAGAGGGGAGG + Intergenic
1141981978 16:87556509-87556531 CTGTTTCCAGGGCAGAGGGAGGG + Intergenic
1142202991 16:88770008-88770030 CTCTCTCAGGGGCAGAGGCGTGG - Intronic
1142513198 17:410710-410732 CGGTCTGAAGGGTAAATGGGGGG - Intronic
1143110216 17:4548756-4548778 CTGTACCCAGGGCAGAAGGGCGG - Intronic
1143586426 17:7852920-7852942 CTGGAGCAAGGGCAGAGGGGTGG - Intronic
1144626781 17:16847989-16848011 CAGACTCAGGGGCAGGTGGGGGG - Intergenic
1145017659 17:19409763-19409785 CTGCCTTCAGGGCAGAAGGGAGG - Intergenic
1145152583 17:20519664-20519686 CAGACTCAGGGGCAGGTGGGGGG - Intergenic
1146312626 17:31780846-31780868 CTGACTTATGGGCAGATGGCGGG + Intergenic
1147046027 17:37752899-37752921 CTGTCTCATGGGCAGTTACGAGG - Intergenic
1147342959 17:39766007-39766029 GAGTCTCTTGGGCAGATGGGCGG + Exonic
1148438060 17:47697360-47697382 CCCTCACAAGGGCAAATGGGCGG - Intronic
1151882707 17:76904627-76904649 CTGTTTGCAGGGCAGGTGGGGGG + Intronic
1155555161 18:27010872-27010894 CTGTCTCAAGGGCAGATGGGTGG + Intronic
1156707533 18:39901072-39901094 CTCTCTCTAGAGCAGATGGTAGG + Intergenic
1157529850 18:48410690-48410712 CTGTCTGGAGCGCAGAGGGGTGG - Intronic
1159929954 18:74300381-74300403 CTGTCTCAAAGGTAGCTGGGAGG + Intergenic
1161189312 19:2944425-2944447 CAGGCTCAAGGGCAGATTAGGGG - Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1161885100 19:6988478-6988500 CTGGCTCAAGGTCACATGGCTGG - Intergenic
1162274508 19:9642088-9642110 CTGTCACAAGGGCCAATGGCAGG + Intronic
1162559038 19:11405333-11405355 CCGGCTCAAGCGCAGCTGGGGGG - Exonic
1162807185 19:13144185-13144207 CTGTCTCAAGTGCACTTAGGGGG - Exonic
1163273775 19:16269761-16269783 CTGTCTCAGGGGCACAGGAGTGG + Intergenic
1163797412 19:19345583-19345605 CTGACCCAAGGGCAGACGTGAGG + Intronic
1164175855 19:22773763-22773785 CTGCCTCAATGGCAGATGGTAGG - Intronic
1164433506 19:28208349-28208371 CTGTCCCAGGGGGAGAGGGGTGG + Intergenic
1166202706 19:41248855-41248877 CTGTCTCAGGGGCATAGGGAAGG - Intronic
1168650061 19:58087033-58087055 CCTTCTCTAGGGCAGGTGGGAGG - Intronic
924994723 2:348896-348918 CTGTTTCAAAGACACATGGGTGG - Intergenic
925681125 2:6422214-6422236 ATGTCTCAAGGTGAAATGGGAGG + Intergenic
927966281 2:27271381-27271403 CTGACTCAAGGTATGATGGGAGG + Intronic
928214122 2:29347149-29347171 CTGGCTCAAGGTCACATGGGTGG + Intronic
930002505 2:46870606-46870628 CTGACTCAGAGGCAGAGGGGTGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933258215 2:80104315-80104337 CTGTCCCAAAGGCAGATAGATGG + Intronic
933368993 2:81391228-81391250 GTGTTTCAAAGGCAGATTGGAGG - Intergenic
934527127 2:95058873-95058895 CTGCCTCACAGGCAGCTGGGAGG + Intergenic
936381902 2:111993841-111993863 CTGGTTCAAGGGCAGGTGGCAGG + Intronic
937546269 2:123024866-123024888 CTGTCCCCAGGGCATATGAGAGG + Intergenic
940346032 2:152629933-152629955 CTGTTTGAAGGACAGATGGCTGG + Intronic
942900908 2:181117358-181117380 CAGTCTCAAGGCCAGCTGGAAGG + Intergenic
942987407 2:182160023-182160045 CTGTCTCAAGAGCTGTTAGGAGG - Intronic
944191190 2:197006040-197006062 CTATTTCAAGGGCAGAAGGCAGG + Intronic
945046288 2:205784687-205784709 CTGGCACAAAGGCAGATGAGTGG - Intronic
945769261 2:214019983-214020005 CTGTCTCAAGAGCTGATTGATGG + Intronic
946392223 2:219423415-219423437 CGGTCTCAGGGAAAGATGGGAGG + Intronic
946819836 2:223618337-223618359 TTGTCTCAAATGCAGATGAGGGG + Intergenic
947045441 2:225977871-225977893 ATGTCTAGAGGTCAGATGGGAGG - Intergenic
948852519 2:240715404-240715426 CTCTCCCAGGGGCTGATGGGGGG - Exonic
1169149705 20:3279766-3279788 GTGTCTCACAGGCAGCTGGGAGG + Intronic
1170906028 20:20515882-20515904 CTGCCTCATGGGCAGACAGGAGG + Intronic
1171516746 20:25744447-25744469 CTGTCTCAAAGCAGGATGGGTGG + Intergenic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1173869194 20:46331094-46331116 TTCTCTCAAGGGCAGATGTATGG - Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1175120707 20:56714146-56714168 CTGTAGAAAGGGCAGATGAGGGG - Intergenic
1175289821 20:57868227-57868249 CTTTCTCAAGGGCTGTTTGGTGG + Intergenic
1175667914 20:60876269-60876291 CTGGCTGAAAGGGAGATGGGTGG - Intergenic
1175825907 20:61936424-61936446 CCAACCCAAGGGCAGATGGGGGG - Intronic
1176306040 21:5123644-5123666 CTGTTTCAAGGGCAGGTTGGAGG - Intronic
1176457943 21:6929228-6929250 CTGGCTCCAGGGCATGTGGGTGG + Intergenic
1176836115 21:13794312-13794334 CTGGCTCCAGGGCATGTGGGTGG + Intergenic
1179174280 21:38996076-38996098 CTGTCTGAAGGGCCAAGGGGAGG - Intergenic
1179851017 21:44138387-44138409 CTGTTTCAAGGGCAGGTTGGAGG + Intronic
1179996821 21:44977958-44977980 CTGGCTCCAGGGCATGTGGGTGG + Intergenic
1181786012 22:25227838-25227860 CTGTCTCCATGGCAGCTGGGTGG + Exonic
1182622890 22:31627497-31627519 CTGTTTCCTGGGCAGATGGCAGG - Intronic
1183016058 22:34988350-34988372 CTTTCTCAAGGGCAGTTGAGTGG + Intergenic
1184900627 22:47444415-47444437 ATGTCTGATGGGCAGGTGGGTGG + Intergenic
950014706 3:9747461-9747483 CAGTCTCAGGGGAAGCTGGGTGG + Exonic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
951541963 3:23790264-23790286 CTGTCTCAAGGGCAATTGCATGG + Intergenic
953201208 3:40780136-40780158 TTGTTTCATGGGAAGATGGGAGG + Intergenic
953403200 3:42644852-42644874 CTGTCTTAGAGGCACATGGGAGG - Intronic
954466023 3:50655377-50655399 AGGCCTCAAGGGCAGGTGGGTGG - Intergenic
954625413 3:52019636-52019658 CTGTGTGAGGGGCAGAGGGGTGG + Intergenic
961248425 3:125477896-125477918 GTTTCTGAAGGCCAGATGGGAGG - Intronic
962190154 3:133301917-133301939 CTGTCTCCATGGGAGTTGGGTGG - Intronic
962346778 3:134624559-134624581 ATGTCTCAGGTGCAGGTGGGAGG - Intronic
967356843 3:188581351-188581373 CTGTTTCCAGGGCAGACTGGTGG - Intronic
968771924 4:2512905-2512927 CTGCCCCAAGGGCATGTGGGAGG - Intronic
968984776 4:3869168-3869190 CAGTGTCAAGGGCAGTGGGGAGG + Intergenic
970127684 4:12832595-12832617 ATGTCTCCAGGGCATATGAGAGG - Intergenic
971265865 4:25095774-25095796 CTGACTTAAGGCCAGATGAGTGG - Intergenic
971924287 4:32986796-32986818 CTGGCTCAAGGGCACTTGGAAGG - Intergenic
974722623 4:65761814-65761836 CTGTCTCACGGGGAGAAGAGTGG + Intergenic
975864023 4:78707425-78707447 CTGTCTGAAGGTCAAAGGGGTGG - Intergenic
977203221 4:94140796-94140818 CTCTCTGCAGGGCAGATAGGGGG - Intergenic
977448763 4:97166768-97166790 GTGACTGAAGGGCAGAAGGGTGG + Intergenic
978555190 4:109972334-109972356 CTGTCTCAAGGCAAGATCGCTGG - Intronic
978570537 4:110132236-110132258 CAATGTGAAGGGCAGATGGGAGG + Intronic
984748813 4:183252018-183252040 CTATCATAAGTGCAGATGGGGGG + Intronic
984893553 4:184515200-184515222 CTGTCTGATGGGAGGATGGGAGG - Intergenic
988563101 5:32298456-32298478 CTGTCTCAAGGGCTTCTAGGAGG - Intronic
989101863 5:37830731-37830753 CTGTCTCATGGGTTGATGTGAGG - Intronic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
994689575 5:102999901-102999923 ATGTCTCCAGGGCATATGAGAGG - Intronic
995502393 5:112821662-112821684 CTTAGTCAAGGGCAGATGAGTGG + Intronic
998397291 5:141826820-141826842 CTGTCTCTAGGCCGGCTGGGAGG + Intergenic
999861873 5:155656825-155656847 CTGGCACAAGGGCATCTGGGAGG + Intergenic
1001002838 5:168023560-168023582 ATGCCTCAAGGGCAAATGGATGG + Intronic
1001425122 5:171617818-171617840 CTTGCTCAAGGGGAGATGGAAGG + Intergenic
1001950213 5:175811310-175811332 CTGTCTCCAGGCCAGAAAGGAGG + Intronic
1001996329 5:176162402-176162424 GTGTTTCTAGGGCAGATGGCTGG + Intergenic
1002040309 5:176508689-176508711 CTGTCCCAAGGCCAGATGAGTGG + Exonic
1002089681 5:176797209-176797231 CTATCTGATGGACAGATGGGTGG + Intergenic
1002877771 6:1226583-1226605 CTGTCTCCCAGGCAGATGAGGGG + Intergenic
1007194861 6:40051634-40051656 CTGATACATGGGCAGATGGGAGG + Intergenic
1008303895 6:49876878-49876900 CTGTCAGAAGGGAAGATAGGGGG + Intronic
1016439983 6:144073641-144073663 CTGTAGCAAGGGCTTATGGGAGG - Intergenic
1016469721 6:144362309-144362331 CTGGGTCCTGGGCAGATGGGGGG - Intronic
1018209903 6:161470726-161470748 CTCTCAGAAGGACAGATGGGAGG - Intronic
1019913556 7:4116310-4116332 CTGTCTCGAGGGTGGAGGGGTGG - Intronic
1020175611 7:5879728-5879750 ATGTCTCAAGGGAATGTGGGTGG - Intergenic
1022489150 7:30803465-30803487 CTGTTTCAGGGTCAGATGGATGG + Intronic
1023330736 7:39113846-39113868 TGGTCACAAGGGCTGATGGGAGG + Intronic
1024048357 7:45600574-45600596 CTGTCTCATGGGCAGAAGTCTGG + Intronic
1025791108 7:64687490-64687512 CTGCCTCAGTGGCAGATGGTAGG + Intronic
1026534715 7:71230155-71230177 CTGTCTCATGGGGAGTTGGGAGG - Intronic
1029083218 7:97991241-97991263 ATGTCTCAAGGGAATGTGGGTGG + Intergenic
1032410885 7:131692650-131692672 CTGCCTCAAGGCCCGCTGGGTGG - Intergenic
1032822247 7:135534779-135534801 CTGTCTCAAAAGAAGATGGGAGG + Intergenic
1033130881 7:138744536-138744558 CTGTCTCAAAAGCAAATGAGAGG - Intronic
1034984336 7:155498010-155498032 CTGTGTCAAGGTCAGAAGAGAGG - Intronic
1036678532 8:10853783-10853805 AAGTCCCAGGGGCAGATGGGTGG + Intergenic
1036697047 8:10982160-10982182 CTGTTTCAAAGGCAAATGGTAGG + Intronic
1039640190 8:39211270-39211292 CTGTGGCAATGGCAGATTGGAGG + Exonic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1043591198 8:81835332-81835354 ATGTCTCCAGGGCATATGAGAGG - Intronic
1045061151 8:98412251-98412273 CTGTCTCTAGGGCAGTGAGGTGG + Intronic
1045165987 8:99605736-99605758 CATTCTCCAGGGCAGGTGGGTGG + Intronic
1048934065 8:139340899-139340921 TTGTCACAAGGGCACATGGTTGG - Intergenic
1049804328 8:144532147-144532169 CTGTCCAATGGGCAGAAGGGAGG + Intronic
1053535335 9:38920060-38920082 CTGACTCAAGGGCAGAGGACAGG + Intergenic
1054207556 9:62144464-62144486 CTGACTCAAGGGCAGAGGACAGG + Intergenic
1054630796 9:67443890-67443912 CTGACTCAAGGGCAGAGGACAGG - Intergenic
1056055477 9:82818345-82818367 CTACCTCAAGGGCAGCTGTGGGG + Intergenic
1056827954 9:89890042-89890064 CTGCCCCAAGCGCAGATGGCGGG + Intergenic
1061050713 9:128193078-128193100 CTGGCTCTGCGGCAGATGGGCGG + Intronic
1061163658 9:128910307-128910329 CTGTGTCGGGGGCAGAAGGGTGG - Intronic
1062148231 9:135002621-135002643 CAGTCTCCAGGGAAGAGGGGAGG - Intergenic
1186708868 X:12171959-12171981 GTGTGTTAAGGGCTGATGGGAGG - Intronic
1186917859 X:14243405-14243427 CTGTCTCAAAGGCAGTTAAGTGG + Intergenic
1187004209 X:15215939-15215961 CTGTCTCATGGGCAGATCTCAGG + Intergenic
1187360983 X:18627570-18627592 CTGACTTCAGGGCAGAGGGGAGG - Intronic
1187427958 X:19195745-19195767 CTCTCTCAAAGGCAGAAGTGGGG - Intergenic
1190526500 X:51333546-51333568 CGGTCTCATGGGCAGGAGGGAGG + Intronic
1195948122 X:110237429-110237451 CTGACTCTAGGGAAAATGGGTGG + Intronic
1200380670 X:155834355-155834377 ATGTCTCCAGGGCATATCGGAGG + Intergenic
1200411804 Y:2868438-2868460 GTGTCTCCAGGGCCCATGGGGGG - Intronic