ID: 1155556118

View in Genome Browser
Species Human (GRCh38)
Location 18:27021092-27021114
Sequence TCATTCTTCCCTAGCACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155556118_1155556127 20 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556127 18:27021135-27021157 GCTGGGAATAGGCTGCAGTTGGG No data
1155556118_1155556119 -7 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556119 18:27021108-27021130 AGAATGAAAGTTCAAGTGAAAGG No data
1155556118_1155556123 2 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556123 18:27021117-27021139 GTTCAAGTGAAAGGGGAGGCTGG No data
1155556118_1155556120 -6 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556120 18:27021109-27021131 GAATGAAAGTTCAAGTGAAAGGG No data
1155556118_1155556126 19 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556126 18:27021134-27021156 GGCTGGGAATAGGCTGCAGTTGG No data
1155556118_1155556125 9 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556125 18:27021124-27021146 TGAAAGGGGAGGCTGGGAATAGG No data
1155556118_1155556124 3 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556124 18:27021118-27021140 TTCAAGTGAAAGGGGAGGCTGGG No data
1155556118_1155556121 -5 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556121 18:27021110-27021132 AATGAAAGTTCAAGTGAAAGGGG No data
1155556118_1155556122 -2 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556122 18:27021113-27021135 GAAAGTTCAAGTGAAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155556118 Original CRISPR TCATTCTTCCCTAGCACATA AGG (reversed) Intronic