ID: 1155556123

View in Genome Browser
Species Human (GRCh38)
Location 18:27021117-27021139
Sequence GTTCAAGTGAAAGGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155556118_1155556123 2 Left 1155556118 18:27021092-27021114 CCTTATGTGCTAGGGAAGAATGA No data
Right 1155556123 18:27021117-27021139 GTTCAAGTGAAAGGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155556123 Original CRISPR GTTCAAGTGAAAGGGGAGGC TGG Intronic