ID: 1155556953

View in Genome Browser
Species Human (GRCh38)
Location 18:27030595-27030617
Sequence CCCGGCAGCCGGCAGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155556953_1155556958 11 Left 1155556953 18:27030595-27030617 CCTGTGCACTGCCGGCTGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 189
Right 1155556958 18:27030629-27030651 ATGTGCCAGACCCCCTGTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155556953 Original CRISPR CCCGGCAGCCGGCAGTGCAC AGG (reversed) Intronic
900511303 1:3062330-3062352 CCCCGCCGCCGCCAGTACACCGG - Intergenic
900563810 1:3322635-3322657 CCTGGCAGCCTCCAGTCCACAGG + Intronic
900918112 1:5652485-5652507 CCCTGCAGCCAGCAGGGTACAGG - Intergenic
901402734 1:9025690-9025712 CCCGGCAGTCGCCTGTGCTCAGG + Intronic
901417134 1:9125095-9125117 GCCAGCAGCCGGCAATGCAATGG - Intronic
903534903 1:24060468-24060490 CCGGGCAGGCAGCAGAGCACAGG - Intronic
904921575 1:34012228-34012250 CCCGGCAGCGGGAAGAGCAAGGG - Intronic
905145416 1:35883747-35883769 CCCGGCAGGTGGCAGGGGACGGG + Intronic
905684946 1:39901509-39901531 CCCGGCAGCCGACTGTGCCGAGG - Intronic
905929872 1:41779533-41779555 CCCAGCAGGCGGGAGTGCAGTGG + Intronic
905971550 1:42145811-42145833 CCCAGCAGCCGGCCGGGCGCTGG - Intergenic
908403125 1:63789402-63789424 CCCGACAGCAGGCAGTGCTCAGG - Intronic
910056697 1:83041631-83041653 CCCTGCTGCCCGGAGTGCACTGG + Intergenic
911086341 1:93980492-93980514 CACTGCTGCCGCCAGTGCACAGG + Intergenic
911651497 1:100394152-100394174 CCCCACAGGCTGCAGTGCACTGG + Intronic
912450505 1:109765035-109765057 CCCAGCAGCTGGCTGTCCACTGG - Intronic
913289758 1:117261256-117261278 CTCTGCAGCTGGCAGAGCACAGG + Intergenic
917202645 1:172533372-172533394 CCCGGCAGCCGCCACTGCCGAGG - Exonic
919331856 1:196182007-196182029 CCCAGCAGCCGGCTCTGCAGAGG - Intergenic
1062974303 10:1672247-1672269 CTGGGCAGCCCGCAGTCCACAGG - Intronic
1063178002 10:3569795-3569817 CCCTGCAGCCAGCACTGCCCAGG + Intergenic
1066391877 10:34983578-34983600 CCCAGCAGGCGGGAGTGCAGTGG + Intergenic
1066592228 10:37007986-37008008 GCCGGCAGCCTGCAATGCAACGG + Intergenic
1070265201 10:74895577-74895599 CCAGGCAGCCTGGAGTGCAGTGG + Intronic
1072151898 10:92690387-92690409 CCCGGCAGGTGGCAGCGCCCGGG + Intronic
1076353462 10:129834598-129834620 ACCTGCAGCCAGCAGTGCCCGGG + Intergenic
1079114667 11:17633775-17633797 CCCAGCACCTGGCAGTGCTCTGG - Exonic
1080920047 11:36699928-36699950 CCTGACAGCAGGCAGGGCACAGG + Intergenic
1082793887 11:57366205-57366227 CCACGCAGCAGGAAGTGCACTGG + Intronic
1083657827 11:64238216-64238238 CCCTGCAGCCTCCAGTGCCCAGG + Intronic
1083658105 11:64239854-64239876 CCCTGCAGCCTCCAGTGCCCAGG + Intergenic
1083781703 11:64921680-64921702 CCAGGCAGCTGGCAGGGAACTGG + Intronic
1083863633 11:65441234-65441256 CCATGCAGCCTGCAGTGCAGAGG - Intergenic
1084086275 11:66856804-66856826 CCCGGCATCCTGCACCGCACGGG - Intronic
1084537098 11:69763740-69763762 GCCGGGAGCCGGCCGAGCACAGG + Intergenic
1088849501 11:113693410-113693432 CCCAGCAGCCGGCAAGACACTGG + Intronic
1089254685 11:117188006-117188028 CCCCACAGCCGGCAGTCAACCGG - Intronic
1092072462 12:5642784-5642806 CTCTGCAGCGGGGAGTGCACAGG - Intronic
1095098863 12:38161730-38161752 CGCGGCAGCCTACAGTGCTCCGG - Intergenic
1096718683 12:53505774-53505796 CACGGCAGCAGGCAGGGCCCAGG - Exonic
1097123237 12:56752407-56752429 CCCGGCGGCCCGCAGTCCGCCGG + Intronic
1097658159 12:62394807-62394829 CCAGGCAGCCTGGAGTGCAGTGG - Intronic
1101866363 12:108523381-108523403 CCCACCACCCAGCAGTGCACTGG - Exonic
1102552277 12:113700179-113700201 CATGGCAGCAGGCAGTGCAGGGG - Intergenic
1102646150 12:114405311-114405333 CCCCGCGGCCGGCAGTGAATGGG - Intronic
1103620278 12:122183273-122183295 CCCAGCTGCCGGCACCGCACGGG - Exonic
1110998392 13:82143037-82143059 CCTGGCAGCCAGCAATGCAATGG + Intergenic
1112318181 13:98383414-98383436 CCTGGCAGCAGCCGGTGCACTGG - Intronic
1112424228 13:99282093-99282115 CCAGCCACCCTGCAGTGCACGGG - Intronic
1114266983 14:21078419-21078441 CCCGGCTGACGGCACTGCAGAGG + Exonic
1115235664 14:31207200-31207222 CCCCGCCGCCGGCAGGGCCCCGG + Exonic
1118277206 14:64395747-64395769 CCGAGCATCCTGCAGTGCACAGG + Intronic
1119543025 14:75453012-75453034 CCCGGCAGCCTGCAGGGGCCAGG - Intronic
1121718234 14:96091300-96091322 AGGGGCAGGCGGCAGTGCACAGG + Exonic
1122840838 14:104461851-104461873 CCGGGCAGCCGGGAGGGCGCAGG - Intergenic
1122846752 14:104504409-104504431 GCCGGCAGCTGGCACAGCACAGG + Intronic
1129434635 15:75528738-75528760 CCCAGCAGACTGCAGTGCAGTGG + Intronic
1129464647 15:75717063-75717085 GCAGGCAGCCGGCTGTCCACTGG - Intergenic
1129696317 15:77742375-77742397 CCCGGCACCTGGAAGTGCTCAGG - Intronic
1129720599 15:77875950-77875972 GCAGGCAGCCGGCTGTCCACTGG + Intergenic
1130607312 15:85329611-85329633 CCAAACAGCCTGCAGTGCACAGG + Intergenic
1131054508 15:89367677-89367699 CCCGGCCGCCCCCAGCGCACTGG - Intergenic
1131096034 15:89654952-89654974 CGCGGAAGCCGGGACTGCACCGG - Intronic
1132408414 15:101559202-101559224 CGCTGCCGCCGGCAGTGCAGGGG + Intergenic
1132578875 16:676160-676182 CCCAGGAGCTGGCAGGGCACTGG - Intronic
1132865640 16:2091494-2091516 CCCGGCGGCCGGCCGCGCCCTGG - Exonic
1132889534 16:2196885-2196907 CGCGGCCGCCGGGGGTGCACTGG + Intergenic
1133316639 16:4888842-4888864 CACAGCAGCCGGCAGTGCCTCGG + Intronic
1136348972 16:29694927-29694949 CCCAGCAGCAGGCAGTGGGCAGG - Exonic
1141106944 16:81241713-81241735 CCAGGCAGCCTGCAGAGAACAGG + Intronic
1141117196 16:81319137-81319159 CCAGGCAGGCTGCAGTGCAGTGG - Intronic
1144950880 17:18992784-18992806 CCCGGCACCAGGCAGGGAACAGG - Intronic
1148077143 17:44944280-44944302 CCCAGCAGCCTGGAGTGCAATGG + Intronic
1148215243 17:45830596-45830618 CCCGGCGGCCGCCACTGCCCAGG - Intronic
1151765839 17:76132743-76132765 CCCGGCAGGGGGCAGTGGGCTGG - Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152450751 17:80378025-80378047 CCAGACAGCCTGCAGTGCACAGG - Intronic
1152558441 17:81066244-81066266 CCGGGCAGCTGGCAGAGGACAGG - Intronic
1152608053 17:81302877-81302899 CCCGGCCGCAGGCTGTGCCCCGG - Intergenic
1152716794 17:81904129-81904151 CCCAGCAGCCGGGAGTGCAGCGG - Intronic
1155516426 18:26627958-26627980 CCCGGCAGCCTGCAGATCCCTGG - Intronic
1155556953 18:27030595-27030617 CCCGGCAGCCGGCAGTGCACAGG - Intronic
1157712368 18:49858762-49858784 CCAGGCAGCCCACAGTGCTCAGG + Intronic
1160572229 18:79826062-79826084 CAGGGCGGCCGGCAGGGCACAGG - Intergenic
1160811625 19:1015355-1015377 CTCGGCACCCCGCAGTGCCCAGG + Intronic
1161055442 19:2188564-2188586 CTCGGCACCCTGCAGTGCCCAGG - Intronic
1161121190 19:2527715-2527737 CCCAGCACCCTGCAGTGCCCAGG - Intronic
1161138580 19:2635082-2635104 CTCAGCAGCCTGCAGTGCCCAGG - Intronic
1161138759 19:2635996-2636018 CTCAGCAGCCTGCAGTGCCCAGG + Intronic
1161155169 19:2728780-2728802 CTCGGCACCCTGCAGTGCCCAGG - Intronic
1161162614 19:2769453-2769475 CCCAGCACCCTGCAGTGCCCAGG + Intronic
1161210467 19:3062699-3062721 CCCGGCAGCCGGCCGGGCCTCGG + Exonic
1161328641 19:3675784-3675806 CTCGGCACCCTGCAGTGCCCAGG - Intronic
1161391833 19:4025158-4025180 CTCAGCAGCCTGCAGTGCCCAGG - Intronic
1161424607 19:4196081-4196103 CTCGGCACCCTGCAGTGCCCAGG + Intronic
1161481981 19:4515707-4515729 CTCGGCACCCTGCAGTGCCCAGG + Intronic
1161553722 19:4928713-4928735 CTCGGCACCCTGCAGTGCCCAGG - Intronic
1161568535 19:5017028-5017050 AGCGGCGGCCGGCAGAGCACCGG + Intronic
1161659910 19:5539675-5539697 CCGGGCAGCAGGCAGAGGACAGG + Intergenic
1162119959 19:8458520-8458542 CCAGGCAGCCGGCAGCACCCAGG + Intronic
1162726812 19:12694900-12694922 GCCGGCAGCCTGCATTGCGCTGG - Exonic
1163127259 19:15251073-15251095 CCCAGCAGCATGCAGTGCAGTGG - Intronic
1165055972 19:33176601-33176623 CCCGGGAGCTGGCAGGGCCCCGG + Intergenic
1166209949 19:41300061-41300083 ACAGGAAGCGGGCAGTGCACTGG - Intronic
1168314407 19:55478142-55478164 CTCGACACCCTGCAGTGCACAGG + Intronic
1168645885 19:58059259-58059281 ACCGGCAGCCGACACTGCGCCGG - Exonic
927855319 2:26524025-26524047 CTCTGCAGCCAGCAGTGCCCTGG + Intronic
927981468 2:27377568-27377590 CCCGGCTGCCAGCAGTCCCCAGG + Exonic
929694499 2:44102561-44102583 CCCATCAGCCGTCAGTGCAGAGG + Intergenic
932347766 2:71006908-71006930 CCCTGCAGCTGGCAGTGCAGGGG + Intergenic
942509756 2:176685368-176685390 CCTGACAGCCTGCAGAGCACGGG - Intergenic
944423731 2:199557701-199557723 CCCGGGAGCGGGGAGTGCAAGGG + Intergenic
944615188 2:201452064-201452086 CCCGCCAGCCGCCGGTGCTCGGG - Intronic
948584603 2:239011560-239011582 CACGGCAGCCGGCAAGGCATGGG + Intergenic
948627231 2:239276636-239276658 CCAGGCAGCGGGCAGTGTCCAGG - Intronic
948627236 2:239276654-239276676 TCCGGCAGCAGGCAGTGTCCAGG - Intronic
948627238 2:239276672-239276694 CCAGGCAGCAGGCAGTGTTCCGG - Intronic
1170201353 20:13747523-13747545 CTCGGCAGGCTGCAGTGCAGTGG - Intronic
1175674292 20:60933711-60933733 CCCGGGTGCAGGCTGTGCACTGG + Intergenic
1175893428 20:62325330-62325352 CCCGGTAGCTGGCGGGGCACAGG + Exonic
1175999273 20:62824848-62824870 CCCGCCACACGGCAGCGCACAGG - Intronic
1176072372 20:63234006-63234028 CCAGTCTGCCCGCAGTGCACCGG - Intergenic
1176112606 20:63417458-63417480 CACGGCAGCTGGCAAAGCACCGG + Intronic
1176800763 21:13427338-13427360 TCCAGCAGCCTGCAGTGCAATGG - Intergenic
1179501209 21:41810102-41810124 CCCGCCAGCGGGCCGCGCACCGG - Intronic
1179525525 21:41973711-41973733 TCTGGCAGCCGGCAGTGCACAGG + Intergenic
1179926472 21:44537899-44537921 CCCAGCAGCCGTCAGTGCGGAGG + Intronic
1180833841 22:18919975-18919997 CCCCGCATAGGGCAGTGCACTGG - Intronic
1180840755 22:18957811-18957833 CCAGGCTGCCTGCAGTGGACCGG + Intergenic
1181043122 22:20202270-20202292 CCAGGCAGCCGGCACTACACGGG - Intergenic
1181060730 22:20280963-20280985 CCAGGCTGCCTGCAGTGGACCGG - Intronic
1181781613 22:25197883-25197905 CTCAGCATCCTGCAGTGCACAGG + Intergenic
1183380053 22:37486158-37486180 CGCGGGAGCCGGCACTGCATTGG + Exonic
1183486265 22:38089179-38089201 CCCCGCAGCCGGCACGGCTCCGG - Exonic
1183821054 22:40346408-40346430 CTCCGCAGCCGGCAGCGCCCAGG + Intergenic
1184723021 22:46326527-46326549 CCCGCCAGCCGGCGCTGCTCTGG + Exonic
1203283927 22_KI270734v1_random:145273-145295 CCCCGCATAGGGCAGTGCACTGG - Intergenic
950032672 3:9862794-9862816 CCCGGCAGCCCGCAGGGGTCAGG + Intergenic
950365945 3:12484358-12484380 CCCGCCAGCCGGCCGTGCGCAGG + Intergenic
950636332 3:14317779-14317801 CCGGGCAGCAGAGAGTGCACAGG - Intergenic
950888069 3:16378012-16378034 CTCGGCAGGCAGCAGTGCTCCGG - Exonic
956678478 3:71755696-71755718 CCCTGCAGCCGGCAATTCAGAGG - Exonic
959579679 3:107970650-107970672 CCCGGGAGCCGGTAGTCCAGGGG + Intergenic
959581156 3:107983881-107983903 CCCAGCCTCCGGCAGTGTACAGG - Intergenic
961345785 3:126262524-126262546 CAGGGCAGCATGCAGTGCACAGG + Intergenic
961602213 3:128071068-128071090 CACGGCAGCCTGCAAAGCACAGG + Exonic
961816524 3:129553469-129553491 CCAGGCAGCCTGCAGTGCGGGGG + Intergenic
963989153 3:151633444-151633466 CCCTGCATCCAGCAGTGCTCTGG - Intergenic
965590461 3:170357066-170357088 CCCAGCAGCCGGCAGGGCGGAGG - Intergenic
967457893 3:189710900-189710922 CTTGGCAGCAGTCAGTGCACAGG - Intronic
967685163 3:192409492-192409514 CCCGGCAGTCAGCAGCTCACAGG + Intronic
968574064 4:1356851-1356873 CCCTGCACCAGGCACTGCACCGG + Intronic
968605266 4:1532381-1532403 CCAGGCAGCCAGCTGGGCACAGG + Intergenic
968910860 4:3476327-3476349 CCCGCCTGCCCGCAGTGCATAGG + Exonic
969371233 4:6732837-6732859 CCAGGCAGCCCGCAGTGGCCAGG + Intergenic
969706375 4:8794364-8794386 CCCTGCAGCCGGCATTGTGCCGG + Intergenic
971216893 4:24670504-24670526 CGCGGGAGCAGGCAGTTCACAGG + Intergenic
972237350 4:37149946-37149968 CCCGGAAGCCAGCACAGCACTGG + Intergenic
973710083 4:53621268-53621290 CCAGGCAGAGGGCACTGCACAGG - Intronic
976182812 4:82415156-82415178 CCTGGCAGGCTGCAGTGCAGTGG + Intergenic
983513309 4:168631686-168631708 CCCGGGAGCCGGCGGGGCCCAGG + Intronic
985672888 5:1215139-1215161 CCCAGCTGCCTGCAGTGCCCAGG - Intronic
991343600 5:65639042-65639064 CCAGGCAGCCTGGAGTGCAGTGG - Intronic
994090504 5:95805873-95805895 CCCGCCAGGCTGCAGTGCAGTGG + Intronic
999696197 5:154190521-154190543 CCCGGCATCCTGCAGCGCCCGGG + Intronic
999710324 5:154312796-154312818 CCTGGCAGCTGGCAGCTCACTGG + Intronic
1002059791 5:176619593-176619615 CCCTGCAGCCAGCAGAGCCCTGG - Intergenic
1007264720 6:40587729-40587751 CTCGGCAGCGGGCAGGGCAGCGG - Intergenic
1008815141 6:55556136-55556158 CCTGGCAGACAGCAGTGAACAGG + Intronic
1012059663 6:94462748-94462770 CCCTGAAGCCAGCATTGCACTGG + Intergenic
1018052916 6:160027225-160027247 CCAGGCAGGCGGCAGTGCCGGGG - Exonic
1018083290 6:160277283-160277305 GCCTGCAGCTGGCAGTGCCCAGG - Intronic
1019256993 7:58945-58967 CCTGGCAGCCGGGAATGAACAGG - Intergenic
1022450448 7:30509048-30509070 CCCCGCAGCCCGCAATGCAATGG + Intronic
1024766802 7:52669256-52669278 CCCGGCAGCCTGGAGTCCCCAGG - Intergenic
1027263598 7:76481696-76481718 CTCGCCATCCGGCAGTGCACTGG + Intronic
1027314970 7:76979808-76979830 CTCGCCATCCGGCAGTGCACTGG + Intergenic
1028327483 7:89545138-89545160 GCCAGCAGCCTGCAATGCACTGG + Intergenic
1029133832 7:98354530-98354552 CTCGGCAGCGGGCACTGCCCAGG + Intronic
1029139393 7:98400083-98400105 CCCGGCAGCCAGGACAGCACGGG + Intronic
1029494276 7:100888948-100888970 CCCAGCAGCCTGTAGTTCACTGG + Exonic
1036794200 8:11743527-11743549 CCCAGCGGCCAGCAGTGCCCAGG + Intronic
1037004984 8:13767328-13767350 GCCAGCAGCCCGCAGTGCAACGG + Intergenic
1039250020 8:35652967-35652989 CCAGGCAGGCTGCAGTGCAGTGG + Intronic
1039474204 8:37830789-37830811 CCAGGTAGCTGGCAGAGCACTGG - Exonic
1040803238 8:51366701-51366723 CCTGACAGTGGGCAGTGCACAGG + Intronic
1041713000 8:60910234-60910256 CCCCCCAGCCAGCAGAGCACAGG - Intergenic
1042903061 8:73747085-73747107 CCCGGCAGCCGCCAGGGGGCGGG - Intronic
1045596299 8:103660077-103660099 CACGGCAGCAGGCAGGGCCCAGG - Intronic
1047271343 8:123362251-123362273 CCCAGCAGGCTGCAGTGCAGTGG - Intronic
1048422288 8:134288976-134288998 GCCGGCAGCCTGCAATGCAACGG - Intergenic
1049595279 8:143480574-143480596 CCTGGGGGCAGGCAGTGCACTGG - Intronic
1060283437 9:122228682-122228704 GCCGGCAGCCGGCAGCCCTCGGG + Exonic
1060345215 9:122809909-122809931 GCCAGCAGCCTGCAGTGCAACGG - Intronic
1061710888 9:132486969-132486991 CCAGGCAGGCGGCAGAGCGCAGG + Intronic
1062565186 9:137161188-137161210 CCGGGCAGCCGTGAGTGCGCGGG + Exonic
1062630225 9:137460013-137460035 CAGGGCAGCAGGCAGTTCACAGG + Exonic
1188972209 X:36632253-36632275 ACCTGAAGCCGGCAGAGCACTGG + Intergenic
1198267708 X:135024686-135024708 GCCAGCAGCCGGCAATGCAACGG - Intergenic