ID: 1155558571

View in Genome Browser
Species Human (GRCh38)
Location 18:27049968-27049990
Sequence CCGGAGCCTGCACTTTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155558571_1155558575 5 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558575 18:27049996-27050018 CAAATCAAGTTTTAGAAGTATGG 0: 1
1: 0
2: 1
3: 25
4: 286
1155558571_1155558578 8 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558578 18:27049999-27050021 ATCAAGTTTTAGAAGTATGGGGG 0: 1
1: 0
2: 1
3: 10
4: 170
1155558571_1155558576 6 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558576 18:27049997-27050019 AAATCAAGTTTTAGAAGTATGGG 0: 1
1: 0
2: 1
3: 38
4: 410
1155558571_1155558577 7 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558577 18:27049998-27050020 AATCAAGTTTTAGAAGTATGGGG 0: 1
1: 0
2: 2
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155558571 Original CRISPR CCGGAGCCTGCACTTTGTTG AGG (reversed) Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG + Intronic
901789460 1:11646767-11646789 CCGGAGCCTGCACTGGGCTATGG - Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
905576383 1:39048077-39048099 CCTGGGCCTGCACTTTGATTTGG - Intergenic
907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG + Intergenic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
913068641 1:115280308-115280330 CTGGAGGCTGCACTTAGCTGTGG + Intergenic
916394061 1:164366050-164366072 CCTGAGTATGCACTTTGTGGTGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919594655 1:199546827-199546849 CCAGAGCCGGCACTATCTTGGGG + Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
922345093 1:224689925-224689947 CCCAAACCTGCACTTTGTAGGGG - Intronic
1072254158 10:93604595-93604617 CCTGTGCCTGCACTTAATTGGGG - Intergenic
1072478599 10:95787580-95787602 CCAGAGCCTGCACTTAACTGGGG - Intronic
1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG + Intergenic
1076798939 10:132811833-132811855 CCAGGGCCTGCACTTGGGTGGGG - Intronic
1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG + Intergenic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG + Intronic
1085694444 11:78692042-78692064 CAGGTCCCTGCTCTTTGTTGTGG - Intronic
1094625796 12:32123025-32123047 GCGGAGCCTACATTTTGTGGGGG + Intronic
1098197930 12:68021924-68021946 CCAGAGTTTGCACTTTGATGTGG - Intergenic
1103000653 12:117383187-117383209 CCTGAGCCTGCCCTTTTGTGGGG + Intronic
1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG + Intronic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1119613508 14:76083250-76083272 CCGGCGCGAGCACTTTGGTGAGG - Exonic
1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG + Intronic
1125471712 15:40010932-40010954 CCAGAGCCTGGCCTTTGTTAGGG + Intronic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG + Intergenic
1129123095 15:73414999-73415021 CAGGAGCCTCCACTGTGATGAGG - Intergenic
1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG + Intronic
1131972101 15:97903450-97903472 TCGGTGCCTGCAATTGGTTGGGG + Intergenic
1134182782 16:12061229-12061251 AGGGAGCCTGCAGTCTGTTGGGG - Intronic
1135354187 16:21755969-21755991 CAGGAGCCTGAACTGTGTTCTGG + Intronic
1135452677 16:22572110-22572132 CAGGAGCCTGAACTGTGTTCTGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143745629 17:8992055-8992077 CCAGAGCCTGCAGTGTCTTGTGG - Intergenic
1145124235 17:20286957-20286979 CAGGAGCCAGGACTTTCTTGGGG - Intronic
1145366685 17:22271371-22271393 CCTGACACTGGACTTTGTTGGGG - Intergenic
1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG + Intergenic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG + Intronic
1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG + Intergenic
1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG + Intergenic
1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1159713799 18:71796940-71796962 TTGGAGACTGCACTTTGTGGAGG + Intergenic
1159954413 18:74509239-74509261 ACAGAGCCTGCACTATGTTCTGG - Intronic
1162100136 19:8334333-8334355 CAAGAGCCTGCAGTTTGTTGGGG - Exonic
1165728826 19:38131159-38131181 AGGGAGCAGGCACTTTGTTGTGG - Intronic
1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG + Exonic
925092946 2:1169645-1169667 CCGGAGCCTGCAGGTTTTAGTGG - Intronic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
938605152 2:132884423-132884445 CCGGAGCCTGCTCTTCCTTTTGG - Intronic
945053827 2:205850524-205850546 TAGGGGCCTGCTCTTTGTTGGGG - Intergenic
1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG + Intronic
1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG + Intronic
1177009735 21:15717338-15717360 AAGGTGCCTGCACTTTGTAGAGG - Intergenic
1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG + Intergenic
1184198325 22:42947172-42947194 CAGGAGGCTGCCCTTTGTTCAGG + Intronic
949341953 3:3039796-3039818 CCAGAGCTTGCTCTTTGATGGGG - Intronic
949687512 3:6592742-6592764 CCGGGGCCTGTCCTTGGTTGGGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951520822 3:23609363-23609385 CCAGAGTCTGGACTTTGCTGAGG - Intergenic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
968709430 4:2102251-2102273 GTGGATCCTGCACTCTGTTGGGG - Intronic
969493034 4:7510674-7510696 CCGGGGCCGGCACCTTGTTCTGG + Intronic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
984832262 4:183986781-183986803 CCAGAGCCTGAGCTCTGTTGGGG + Intronic
992747689 5:79835443-79835465 CCGGGGCCTGAGCTTGGTTGCGG + Intergenic
1002174767 5:177395553-177395575 TCAGAGCCTGGACTTTATTGAGG + Intronic
1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG + Intergenic
1023836853 7:44073611-44073633 CCGGAGCAGGTACATTGTTGGGG - Exonic
1024809826 7:53195741-53195763 CCGGAGCCTGCACCTTCCAGTGG - Intergenic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1031973303 7:128078804-128078826 CCTGAGCCTGCAAGCTGTTGAGG - Intronic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1035243657 7:157548550-157548572 CCGGGGCCTGCGCTTTGTGGAGG - Intronic
1036971767 8:13363073-13363095 ACAGAGCCTACACTTTGTGGGGG + Intronic
1039978335 8:42385663-42385685 CAGGAGCCTGGACTTTGTGCTGG - Intergenic
1049331928 8:142059227-142059249 CCGCACCCTGCAGTTTGGTGTGG - Intergenic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1061651834 9:132056814-132056836 CTGGAGCCAGCTCTTTGTTCTGG - Intronic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1193865475 X:86725787-86725809 CTGGTGCCTGCAATTGGTTGTGG + Intronic