ID: 1155558575

View in Genome Browser
Species Human (GRCh38)
Location 18:27049996-27050018
Sequence CAAATCAAGTTTTAGAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155558571_1155558575 5 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558575 18:27049996-27050018 CAAATCAAGTTTTAGAAGTATGG 0: 1
1: 0
2: 1
3: 25
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155558575 Original CRISPR CAAATCAAGTTTTAGAAGTA TGG Intronic
901158991 1:7160641-7160663 CAAAGAAAGTTTTTAAAGTAAGG - Intronic
902524869 1:17049953-17049975 TAAATCAGGCTTTAGAACTAGGG - Intronic
902714790 1:18265308-18265330 CATATCACCTTTCAGAAGTAGGG + Intronic
903713680 1:25346400-25346422 AAAAAAATGTTTTAGAAGTAGGG + Intronic
905195991 1:36277714-36277736 CAAATGAGTTTTTAGATGTATGG + Intronic
906918095 1:50033359-50033381 CAAATGAAATTTGAGAAGTTTGG + Intergenic
909618314 1:77637962-77637984 TCAATCTAGTTTTAGAAATAAGG + Intronic
911579081 1:99614618-99614640 AAAATAAACTTTTTGAAGTATGG + Intergenic
911601375 1:99851227-99851249 CAAATCAAGTTTTAGACCCTTGG - Intronic
911717995 1:101157236-101157258 AAAATTAAGTTTAAAAAGTAAGG + Intergenic
911908719 1:103602932-103602954 CAAATCTAATTTTAGAAGTCAGG + Intergenic
911911022 1:103635270-103635292 CAAATCTAATTTTAGAAGTCAGG + Intergenic
911914198 1:103676529-103676551 CAAATCTAATTTTAGAAGTCAGG - Intronic
911918437 1:103729412-103729434 CAAATCTAATTTTAGAAGTCAGG + Intronic
915122914 1:153643018-153643040 CAAATCCATTTTTGGAAGTTGGG - Intronic
916518188 1:165539838-165539860 CAAATCAAGTTTCAGGCATAAGG + Intergenic
917695526 1:177519385-177519407 CATATCAGGTTTTAGACCTATGG - Intergenic
918436969 1:184525053-184525075 CACATCATGTTTTTGCAGTATGG + Intronic
921383339 1:214546832-214546854 CATATCAAATTTTACATGTAAGG + Intronic
921543410 1:216446657-216446679 TGAATCATGTTTTAGAGGTAAGG - Intergenic
1064833937 10:19504432-19504454 CAAATGAATTAGTAGAAGTAGGG - Intronic
1064983985 10:21191857-21191879 CATTTCTAGTTTTAGAAGTTGGG - Intergenic
1065071292 10:22026642-22026664 TACATCAAATTTTAGAAGTTTGG + Intergenic
1068299741 10:55123233-55123255 AAAATAAAGTTTTAAAATTATGG + Intronic
1069009872 10:63360480-63360502 CAAGCCAAGTTTTAAAATTAAGG - Intronic
1069400730 10:68042734-68042756 CAAATCATTTTTCAGATGTAAGG - Intronic
1069978347 10:72233883-72233905 CAAATTACTTTTTAGAAGAAGGG + Exonic
1071075845 10:81751346-81751368 CAAACCAAGTTCCAGTAGTAAGG - Intergenic
1071084601 10:81855067-81855089 CAAAGAAAGTTTTAGAGGTCTGG - Intergenic
1073975028 10:109090700-109090722 GAAATCAAGTATTAAAAGTCAGG + Intergenic
1074236721 10:111592065-111592087 CAATTCTATTTTTAGTAGTAGGG - Intergenic
1074289607 10:112128436-112128458 CAGATCACGTTTTAAAAATATGG + Intergenic
1074742179 10:116496143-116496165 CAAATGAAGTAATAGTAGTAAGG + Intergenic
1078610870 11:12818426-12818448 AAAATAAAGTTAAAGAAGTAAGG + Intronic
1080142663 11:28941524-28941546 CATTTCAAGTTCTAGAAGAAGGG - Intergenic
1080254744 11:30277461-30277483 CAAATGAATTTTGAGAAGTGAGG + Intergenic
1082214853 11:49557483-49557505 CAAAACAAGTTTTAGTACTTTGG - Intergenic
1082267764 11:50138166-50138188 GAAATCAAGTCTAAGAAATATGG - Intergenic
1082288326 11:50340352-50340374 GAAATCAAGTCTAAGAAATATGG + Intergenic
1086024090 11:82269001-82269023 CAAAGCAAGATTTGGGAGTAGGG - Intergenic
1086083184 11:82926519-82926541 CAAATGACATTTTAGAAATATGG + Intronic
1086634730 11:89066987-89067009 CAAAACAAGTTTTAGTACTTTGG + Intergenic
1086692585 11:89805116-89805138 CTAATCAAGTTTCACTAGTAGGG + Intronic
1086713215 11:90034544-90034566 CCAATCAAGTTTCACTAGTAGGG - Intronic
1087614320 11:100470874-100470896 CAAATCAAGTTCTTGGTGTAGGG + Intergenic
1087795038 11:102447271-102447293 AAAAGCATGTTTTAAAAGTAAGG + Intronic
1088363321 11:109013622-109013644 CAAATCAAGATTTCTAACTAAGG + Intergenic
1088856457 11:113759254-113759276 CCAAACAAGTTTAACAAGTAGGG + Intronic
1089804132 11:121067980-121068002 TAACTCAAGTTTTAGAGGTTGGG - Intronic
1092592321 12:9963640-9963662 CAAATTGAATTTTAGGAGTAAGG + Intronic
1093513955 12:19963322-19963344 GAAATCAAGTTTTAATTGTATGG + Intergenic
1094014996 12:25853188-25853210 CTCACCAAATTTTAGAAGTAGGG + Intergenic
1094231544 12:28110097-28110119 TCAATTAAATTTTAGAAGTAAGG - Intergenic
1094233998 12:28142361-28142383 CAAGTCAAATTTTTGAAGGAGGG - Intronic
1097674831 12:62588882-62588904 AAAAACAAGGTTTAAAAGTAGGG - Intronic
1098636595 12:72791820-72791842 AAAATAAAATTTTAGAAGTATGG - Intergenic
1098719413 12:73877323-73877345 GAAACCAAGTTGTAGAAGGAAGG + Intergenic
1099632092 12:85163266-85163288 CAAATCTAGTTTTAGAACATTGG + Intronic
1099641997 12:85301689-85301711 CAAACCCTGTTTTAGTAGTAAGG + Exonic
1100157454 12:91817534-91817556 CAAATGCAGGTTTAGAAATAGGG - Intergenic
1100515116 12:95319990-95320012 CAAAACAAGTTTAAGAACTTAGG - Intergenic
1100972732 12:100088422-100088444 CTAATCAAATTTTGGAAGGATGG + Intronic
1101482189 12:105108312-105108334 CAAATCAACTTTTGCAAGTTTGG + Intronic
1102410254 12:112711350-112711372 CAAATAAACTTTTAGCAGAAAGG - Intronic
1102806348 12:115784087-115784109 GAAATCAAGCATTAGAAGGATGG - Intergenic
1103102812 12:118194714-118194736 CAAATAAAGCTTTAGGAGTCAGG + Intronic
1106664333 13:31835966-31835988 CAAATCAAGATCTAGAATTTAGG - Intergenic
1106729295 13:32522871-32522893 CAAATAATGCTTTTGAAGTAAGG + Intronic
1109249972 13:60007618-60007640 CCAATTAAGTTTTAGAAGTACGG + Intronic
1109535703 13:63716310-63716332 TAAATCAGGTTTCAGAAGAAGGG + Intergenic
1109667743 13:65560484-65560506 CAAATTATATTTTAGAATTATGG - Intergenic
1109691275 13:65893174-65893196 CAATCCAAGATTCAGAAGTAAGG - Intergenic
1109759061 13:66803004-66803026 TAACTCAAATTCTAGAAGTATGG - Intronic
1109994409 13:70104593-70104615 CAACTCATGTTTTATATGTAAGG + Intronic
1110101843 13:71616196-71616218 CAAAGCAATCTTTGGAAGTAAGG - Intronic
1111733344 13:92104364-92104386 AAAATTAAGTTTTAGAACTCTGG - Intronic
1111788633 13:92824113-92824135 CAAATGAAGTTTTAGAATGTAGG - Intronic
1113034334 13:106032272-106032294 CAAACCAAGTTTTAAAAGATTGG + Intergenic
1113209139 13:107954715-107954737 GAAATGAATTTTGAGAAGTATGG - Intergenic
1113412136 13:110099954-110099976 CAAGTCAATTTATTGAAGTATGG - Intergenic
1113668262 13:112156000-112156022 CAAAACAAATTTTTGAAATATGG - Intergenic
1117265072 14:54078075-54078097 TATATTAAGTTTTAAAAGTAAGG + Intergenic
1118489497 14:66245177-66245199 AGAATCAAGTTTTAAAAGGAGGG + Intergenic
1119017270 14:71071789-71071811 CAAATCAAATGCTAGAAATAAGG - Intronic
1120146457 14:80983998-80984020 GAAATCTAGTTATAGAAGTAAGG + Intronic
1120342635 14:83241807-83241829 AGAAACAAATTTTAGAAGTAAGG + Intergenic
1121477300 14:94221506-94221528 CAACCCAATTTTTAGAAATATGG + Intronic
1122031760 14:98917412-98917434 CAAATTAAGTCTTAAAAGGATGG + Intergenic
1123835807 15:24191136-24191158 CACAACAACATTTAGAAGTAAGG + Intergenic
1123845350 15:24295070-24295092 CACAACAACATTTAGAAGTAAGG + Intergenic
1123850973 15:24356533-24356555 CACAACAACATTTAGAAGTAAGG + Intergenic
1123855854 15:24410771-24410793 CACAACAACATTTAGAAGTAAGG + Intergenic
1123864394 15:24502955-24502977 CACAACAACATTTAGAAGTAAGG + Intergenic
1123979917 15:25592002-25592024 CAATTTATTTTTTAGAAGTAGGG - Intergenic
1125786096 15:42319649-42319671 CTCATCAAGTTTTAGAAGTGGGG - Intronic
1128464651 15:67900038-67900060 GAAAGCAAGTTAGAGAAGTAAGG + Intergenic
1128852828 15:70977948-70977970 CAACTCTAATTTTAGAAATAAGG - Intronic
1134324041 16:13190534-13190556 CTAATCCAGTTTTAGAAGGCAGG - Intronic
1135198311 16:20413427-20413449 CAAATACAGTTTTACAAGTAGGG - Intronic
1135219922 16:20605131-20605153 CAAATACAGTTTTACAAGTAGGG + Intergenic
1136656598 16:31712984-31713006 CTAATTAAGTTTAAGAAGGAGGG - Intergenic
1138201868 16:55094631-55094653 AAAATCAACTTTTAGAAGGGAGG - Intergenic
1138778308 16:59752342-59752364 CAAATGAAATATTAGAAGTCAGG + Intronic
1138823624 16:60291698-60291720 AAAATTATGTTTTATAAGTAAGG - Intergenic
1138972897 16:62168523-62168545 CAAATAAAGAATTAAAAGTATGG - Intergenic
1141202053 16:81905644-81905666 TAAATAAAGTTTAAGAAGGAAGG - Intronic
1143675535 17:8429783-8429805 CAAAACAAGTTTTGGAGGCAGGG + Intronic
1145405396 17:22586002-22586024 TAAATCAGGTTATAGCAGTAAGG + Intergenic
1145762962 17:27437517-27437539 CAAATAAATTCCTAGAAGTAGGG - Intergenic
1146080845 17:29779187-29779209 CAAATCAGATTTAAGAAGTATGG + Intronic
1146209888 17:30933796-30933818 CTAATGAAACTTTAGAAGTAAGG - Intronic
1146566607 17:33918770-33918792 CAAAACCTGTATTAGAAGTAAGG + Intronic
1149205145 17:54235144-54235166 CAAACCTAGTTTGAGTAGTATGG + Intergenic
1153938760 18:9957425-9957447 GAAAACAAGTTTTAACAGTAGGG + Intronic
1155444344 18:25895000-25895022 AAAATGAAGATTTAGAAGGAAGG - Intergenic
1155558575 18:27049996-27050018 CAAATCAAGTTTTAGAAGTATGG + Intronic
1159132666 18:64297660-64297682 TAAATCAAGCTTGAGAAGCAAGG + Intergenic
1159312524 18:66727628-66727650 CAAAACAATTTTGAAAAGTAAGG + Intergenic
1160580329 18:79880206-79880228 CAGATCAGCATTTAGAAGTAGGG + Intronic
1162900100 19:13790033-13790055 CAAATAAATTTTTAGAAATGGGG + Intergenic
925852911 2:8100354-8100376 GCAATGAATTTTTAGAAGTATGG + Intergenic
926522620 2:13934348-13934370 CAAAAACAGTTTTAGAAGAATGG + Intergenic
927814519 2:26202756-26202778 CAAATAAGGTCTTAAAAGTATGG + Intronic
928191934 2:29178695-29178717 CAATACATGTTTTAGAAGTCTGG - Intronic
928963060 2:36949430-36949452 CAAATCAATTTTTAGAAGCCTGG + Intronic
930240191 2:48928242-48928264 CAAAACAAGGCTTAAAAGTAAGG - Intergenic
931142737 2:59481355-59481377 CAAATGAAGTTTAAGATGTTAGG + Intergenic
931425478 2:62167352-62167374 CAACTCATATTTAAGAAGTAGGG - Intergenic
931553766 2:63476806-63476828 AAAATCAAGTTCTACAATTAAGG + Intronic
933434878 2:82235896-82235918 CATATGAAGTTTTAGATGTCTGG + Intergenic
934017313 2:87901467-87901489 AAAAACATGTTTTAGAAATATGG + Intergenic
934893578 2:98091756-98091778 CAGTTAAAGTTTTAGAAATAGGG + Intronic
936773554 2:115944480-115944502 AAAAACAAGTTTTAGAAACATGG + Intergenic
939643862 2:144672370-144672392 AAAATCCTGTTTTAGAAGTTGGG + Intergenic
940274395 2:151923778-151923800 CAGATCAATTTTTAGAGGTGAGG - Intronic
940403629 2:153274830-153274852 CAATTCATTTTGTAGAAGTAGGG + Intergenic
940428377 2:153556881-153556903 CAAAGAAAGTTATAGAAATATGG - Intergenic
940975798 2:159942948-159942970 CAAGTCTGGTTTTAAAAGTATGG - Intronic
941346078 2:164371262-164371284 CAAGTCAAGTCTTAGATGGATGG + Intergenic
941754624 2:169171793-169171815 CAAATCAAGCTTTTGGAGGAAGG - Intronic
942337266 2:174902243-174902265 CACATCAATTTTTTCAAGTAAGG + Intronic
943045095 2:182851273-182851295 CAAATAAAGTTTCAGTACTAGGG + Intronic
943629103 2:190230858-190230880 CATGTCAAGTTTTAGTAATAAGG - Intronic
943911684 2:193576720-193576742 CAAAACAAGTTTTATAACAATGG + Intergenic
944506360 2:200416385-200416407 CAATTCAAGTTCTAAAAGAATGG + Exonic
947256327 2:228168748-228168770 CATACCCAGTTTTAGATGTAAGG - Intronic
1170052179 20:12158050-12158072 CAAATTACATTTTATAAGTATGG - Intergenic
1172925087 20:38526753-38526775 CAAATCTAGTGTTAGCACTAAGG + Intronic
1173242336 20:41308459-41308481 CAAATCAAGTTTTAGGCTCAAGG + Intronic
1173722369 20:45270548-45270570 CAATTCAAGTTTTAGAATGAGGG - Intergenic
1174233828 20:49071170-49071192 CAAATCAGGTTTTAAGAGTGGGG + Intronic
1175341785 20:58236172-58236194 CAGATCAAGTTTCTGAAGTTCGG - Intergenic
1176877043 21:14141561-14141583 ACAATCAAGATTTAGAAATAAGG - Intronic
1176895138 21:14368489-14368511 AAAATATAGTTTTTGAAGTAGGG + Intergenic
1177037971 21:16068926-16068948 AAAATCAAGTTTTAATAGGAGGG - Intergenic
1177094323 21:16812565-16812587 CAAATGGAGTTTTAGAACTCAGG - Intergenic
1177580382 21:23014943-23014965 TAAATCAAGTTACAGAATTAAGG + Intergenic
1177639096 21:23823446-23823468 CAATTCAATATTTAGCAGTAGGG - Intergenic
1177693638 21:24542455-24542477 TAAATCAAGTTTTATTAGAATGG + Intergenic
1178072223 21:28981138-28981160 CAGAATAAGTTTTGGAAGTATGG - Exonic
1179282649 21:39947364-39947386 ATAAGCAAGTTTTAGAAATATGG - Intergenic
1179350573 21:40606951-40606973 CAAGTCATGTTTTACAAGGATGG - Intronic
1184126439 22:42490769-42490791 CATATAAAGTTTTAGAAGGAAGG - Intergenic
950874496 3:16258162-16258184 AACATCAAGTTTTGGAAGAATGG + Exonic
950997659 3:17520584-17520606 GAAAACAAGTTATAGAATTAGGG + Intronic
951427537 3:22564936-22564958 CCAAACAAGTTTCAGAAATAAGG + Intergenic
954019079 3:47722722-47722744 AAAATGAATTTATAGAAGTATGG + Intronic
954074912 3:48171020-48171042 CAAAAAAAGTTTTACAAATATGG + Intronic
955131800 3:56177035-56177057 CAAATGATGTTTCAGAAGTGTGG - Intronic
955302850 3:57799753-57799775 AAAATAAAGTTTTAAAAGTTGGG - Intronic
956034272 3:65073451-65073473 CAAATAAAATATTAGAAGAAAGG + Intergenic
956404945 3:68918519-68918541 CAAATGAAGTTTTATAATTTAGG - Intronic
957387264 3:79512370-79512392 CTATTCTAATTTTAGAAGTAAGG - Intronic
957588117 3:82158774-82158796 CAAATCATGTTTTACATGGATGG - Intergenic
957683118 3:83464813-83464835 CAAATTTAGTTTTAGAAATTGGG + Intergenic
957881799 3:86224841-86224863 TAAAGTAAGTTTTAGAATTAAGG - Intergenic
957989339 3:87610094-87610116 TAACCCAAGTATTAGAAGTAAGG - Intergenic
959563709 3:107812956-107812978 CAAATCAAGTTTTAGCCTTTGGG - Intergenic
961436672 3:126923715-126923737 CAAAACAACCTTTAGAAGTAAGG - Intronic
962750571 3:138432236-138432258 CAAATAAGGTTTTAAAAGTGGGG + Intergenic
963668268 3:148218034-148218056 AAAACCAATTCTTAGAAGTAAGG + Intergenic
964012036 3:151903131-151903153 CAAATCAAGTTATGGAAGGCAGG + Intergenic
966143270 3:176781152-176781174 CTAATCAAGTACTAGATGTACGG + Intergenic
971326327 4:25647185-25647207 CAAATCAATTTTTAAAGTTAAGG - Intergenic
971675788 4:29627623-29627645 CAAATTTTGTTTTAGAATTACGG + Intergenic
971734851 4:30434532-30434554 CAAATCAATATTTATAAATATGG - Intergenic
971998193 4:33994332-33994354 TAAATCAAGTTATAGTAGCAAGG - Intergenic
972162126 4:36239892-36239914 CAATTCAAGTCTTACAAGTATGG + Intronic
972274733 4:37546614-37546636 GACACCAAGTTTTAGAAGGAAGG - Intronic
972477773 4:39468110-39468132 CAAATAAAGTTTTCAAAGGAGGG + Intronic
973053562 4:45626531-45626553 TTAATCAAGTTTACGAAGTATGG + Intergenic
975170811 4:71230119-71230141 CAAATCATGTTTAAGAAGTGGGG - Intronic
975192450 4:71481088-71481110 CAAATCCAGTTTTACAAATGAGG + Intronic
975330236 4:73104644-73104666 CAAATGAAGTTTTAGAATTTTGG + Intronic
976119377 4:81762791-81762813 CAAAGAAAGTTTTGGAAGGACGG - Intronic
976667141 4:87607536-87607558 CAAATAAAGCTTTATATGTAGGG - Intergenic
976828077 4:89282726-89282748 CAAATCACTTGTCAGAAGTATGG + Intronic
976870382 4:89785987-89786009 TAAACCAAGATTTAGATGTAAGG + Intronic
976886127 4:89986673-89986695 CAAATGAAGTTTTAGAGGAACGG - Intergenic
977125482 4:93161267-93161289 GAAATCAAGCAATAGAAGTATGG + Intronic
977165959 4:93697381-93697403 CACATCAAGTTTAAGAACTCAGG + Intronic
977746307 4:100551592-100551614 CAAAACAATTTTTAAAACTAAGG - Intronic
978621556 4:110638210-110638232 AAAATCAGGGTTCAGAAGTAAGG - Intronic
978881255 4:113705371-113705393 CTAAACAAGCTTTTGAAGTAGGG - Intronic
978960867 4:114676564-114676586 CATATCAAGATTTAAAACTAAGG - Exonic
979765295 4:124458054-124458076 CCACTGAAGTTTTAGAACTAAGG - Intergenic
979838806 4:125409730-125409752 CAAAACAGGTGTTAGAAGAAAGG - Intronic
979971269 4:127138836-127138858 GAAAACAAGTGTTGGAAGTAAGG + Intergenic
980165122 4:129216467-129216489 CAAATTAACTTTATGAAGTAAGG - Intergenic
980853441 4:138411281-138411303 CAAAACAACCTTTAGAGGTAGGG - Intergenic
981336989 4:143579845-143579867 CAAGTAGAGTTGTAGAAGTAAGG - Intronic
981430289 4:144649644-144649666 CAAGTTAAGTTTTAGAAATGAGG - Intronic
982493160 4:156055246-156055268 CAGATAAAGTTTTAGAATTTTGG + Intergenic
984000935 4:174243665-174243687 AAAATAAAATTTTAGAAGAATGG + Intronic
986111411 5:4722258-4722280 CAAATTAATTATTAGATGTAGGG + Intergenic
986934871 5:12870655-12870677 CAAGTCAAGTATTAGAACTGTGG - Intergenic
987110278 5:14679404-14679426 CAAATCCAGTATTATCAGTAGGG + Intronic
988884177 5:35537293-35537315 GAAATAATGTTTTTGAAGTAAGG + Intergenic
989353862 5:40518838-40518860 CAAATCAAGTCTCAGATCTAGGG - Intergenic
989548804 5:42707901-42707923 CAAATCACTTTTTAGAATGAAGG - Intronic
990805080 5:59651471-59651493 CAAATAAAATTTTGGAAGGAAGG - Intronic
991534798 5:67656793-67656815 CGAATTTAGTTTTAGAAGAAAGG + Intergenic
991903433 5:71482917-71482939 CATATCAGGTTTTAAAAATATGG + Intronic
992491992 5:77254258-77254280 CATATCTACTTTTAAAAGTAAGG - Intronic
993254096 5:85565330-85565352 AAAATCAAGTGTTAGAGGAAGGG + Intergenic
993566326 5:89480431-89480453 CAACTCTAGTTTTAGTAGAATGG - Intergenic
994827830 5:104738458-104738480 AAAATTAAATTTTAGAAGCAAGG + Intergenic
994900296 5:105761829-105761851 CAAGTCACGTTTTACATGTATGG + Intergenic
995061921 5:107820382-107820404 CAAATCAAGCTGGAGAAGGATGG + Intergenic
995330801 5:110943938-110943960 CAAGTCAATCTATAGAAGTAAGG + Intergenic
997015367 5:129927449-129927471 CAATTCAAGTTTTACAAGCTTGG - Intronic
997146150 5:131435557-131435579 CAATTCAAGTTTATGAAGTCTGG + Intronic
999633971 5:153600731-153600753 GAAATCAATTTTTAGCAGCAAGG - Intronic
1000292880 5:159887574-159887596 TAAATCAAGTGGTATAAGTAAGG + Intergenic
1003210157 6:4055953-4055975 AAAGTCAAGTTTTATAACTAAGG - Intronic
1003896385 6:10611859-10611881 TAAAGAAAGTTTTATAAGTAAGG + Intronic
1004513741 6:16304286-16304308 AAAAAAAAGTTTTATAAGTAGGG - Exonic
1004993172 6:21162165-21162187 CAATTTAAGTCTTAGAAGTAAGG + Intronic
1007883652 6:45198558-45198580 CAAATCAAGTTTCAGAACTTGGG + Intronic
1008225937 6:48916825-48916847 CAAATGAAATTAGAGAAGTAAGG + Intergenic
1008594229 6:53025132-53025154 CAAATCAAGATTTAGCTATATGG - Intronic
1008789068 6:55207436-55207458 CATATCAAGTCTGAGAAATATGG + Intronic
1010341568 6:74759501-74759523 CAAATAAAGTTAAAGAACTAGGG + Intergenic
1010527177 6:76916292-76916314 AAGATGGAGTTTTAGAAGTAAGG + Intergenic
1011930466 6:92704654-92704676 CAACTCAAATGATAGAAGTAAGG + Intergenic
1012006921 6:93724587-93724609 CAAAGGAAGGTTTAGAACTATGG - Intergenic
1013017782 6:106176759-106176781 CAAATCTAGTTCAGGAAGTAGGG + Intergenic
1013513677 6:110866511-110866533 CAAAACAGGTTGTGGAAGTAGGG + Intronic
1013747343 6:113361280-113361302 CATCTCAAGTTTTTGAAATAGGG + Intergenic
1014156289 6:118113555-118113577 GAAATGAAGTTTTTTAAGTAAGG + Intronic
1014665233 6:124229757-124229779 CAAGTCAAGTTTTACATGGATGG - Intronic
1019092913 6:169554528-169554550 CAAATCAAAATATTGAAGTAGGG + Intronic
1020003734 7:4770543-4770565 CAAATCAAGTATTTTAAGTTTGG + Exonic
1020595217 7:10198725-10198747 GAATTCAAGTTTTAAAAATATGG + Intergenic
1021120746 7:16792743-16792765 AAAAACAAGTTTTAGAAATTTGG - Exonic
1021493030 7:21240901-21240923 TAAATTAAATTTTAAAAGTATGG - Intergenic
1022610009 7:31861542-31861564 CAAACCAAGTTTTGGAGGAAAGG - Intronic
1022678873 7:32525852-32525874 CAAAAACAGTTTTAGTAGTAGGG - Intronic
1022779220 7:33561039-33561061 CAAAGCAAGTTTTAAAAGGAAGG - Intronic
1024659668 7:51481270-51481292 CAAATAAACTTTTAGAAATTAGG - Intergenic
1025922326 7:65925081-65925103 GAAATGCAGATTTAGAAGTATGG - Intronic
1026286815 7:68970616-68970638 CAAATAAAGTTTATGGAGTAAGG + Intergenic
1028011649 7:85651507-85651529 CAAACAAAGTTATAGAAGTAGGG - Intergenic
1028066803 7:86394527-86394549 CAAATAAATTTTCAGATGTATGG + Intergenic
1028672479 7:93419286-93419308 CAAATAAAATATTAGCAGTATGG - Intergenic
1029997703 7:105024569-105024591 CCAATCAAGTTTTTAGAGTAGGG + Intronic
1030212211 7:107007581-107007603 CACATCCAAGTTTAGAAGTAGGG - Intergenic
1031065356 7:117098731-117098753 CCAGTCTGGTTTTAGAAGTAGGG - Intronic
1031543954 7:123029599-123029621 GAAATCAAATTTAAGAAGAAAGG + Intergenic
1033179813 7:139165326-139165348 CAAATATATTTTTGGAAGTATGG - Intronic
1033875676 7:145815210-145815232 TAGATCAAGTTTTAAAAATATGG - Intergenic
1034608199 7:152337838-152337860 AAAATCAAGTTGTATAAGTGAGG - Intronic
1035002723 7:155627408-155627430 CAAAACAATTTTTAAAACTAAGG - Intronic
1037209174 8:16364080-16364102 AAAATCAATTTTTAAAAGTTTGG - Intronic
1038200971 8:25412376-25412398 CACATGAAGTTTTAGACGTTTGG + Exonic
1038471155 8:27822340-27822362 CAAAGCAACTTTTAAAATTATGG + Exonic
1040826461 8:51626367-51626389 CAAATGAGGTTTTAGAAGCATGG - Intronic
1043122465 8:76344788-76344810 CAGATCAATTTTTAGAGATAGGG - Intergenic
1043616923 8:82136975-82136997 CACTTCACGTTTTAGAATTATGG + Intergenic
1043735592 8:83739052-83739074 GAAATTAAGTTTTAACAGTAGGG - Intergenic
1045107309 8:98905367-98905389 CAAGCCAAGTTTGAGAAGTATGG - Intronic
1046059569 8:109121008-109121030 AAAAACAAGTTTCAGAAGAATGG - Intergenic
1046072703 8:109277404-109277426 CAAATGCAGTCTTAGAAGAAGGG - Intronic
1046134214 8:110005154-110005176 CAAATCATAGTTTAGAACTATGG - Intergenic
1046134217 8:110005216-110005238 CAAATCATAGTTTAGAACTATGG - Intergenic
1046568506 8:115932155-115932177 CAAAACAAGTTCTAGAAAGAGGG + Intergenic
1046799613 8:118411528-118411550 TAAATTATGTTTTAAAAGTAGGG + Intronic
1047378558 8:124331483-124331505 TAAAACAACTTTTAAAAGTAGGG + Intronic
1047430626 8:124788444-124788466 TAAAACAATTCTTAGAAGTAGGG + Intergenic
1047879351 8:129176542-129176564 AAAATCAATTTTTGGAAGGATGG + Intergenic
1050706689 9:8407671-8407693 GAAATCAAGTTTTAAAAATGAGG + Intronic
1052027039 9:23585006-23585028 CAAATCCAGATTGAGAAGTCTGG - Intergenic
1052293222 9:26867919-26867941 ACAAAAAAGTTTTAGAAGTATGG + Intronic
1053377094 9:37616697-37616719 AAAATCTAGTATCAGAAGTAGGG + Intronic
1057358886 9:94355499-94355521 CAAATCTTTTTTTAGAAGAACGG - Intergenic
1057491188 9:95521068-95521090 CAAATCAACTCTCAGAATTAGGG + Intergenic
1058151559 9:101469170-101469192 CAAATTAATTTTTAAAAGTAAGG + Intergenic
1186254700 X:7705855-7705877 CAAATCAGAATTTAGAAGTCAGG + Intergenic
1187652436 X:21423520-21423542 CAAATAAAATTTTAAAAGGAAGG - Intronic
1187852703 X:23606765-23606787 CAAATGAAGTTTAAGAACTTGGG + Intergenic
1188349129 X:29105348-29105370 CCACTAAAGTGTTAGAAGTAAGG + Intronic
1189196478 X:39157981-39158003 CTAATCAAGTGTTAGAAATCTGG - Intergenic
1192110718 X:68361054-68361076 CAAAAAAAGTTTTAAAAGAAGGG + Intronic
1195909815 X:109877697-109877719 CATTTTAAGTTTTAGAAGGAAGG - Intergenic
1196226789 X:113177382-113177404 CAAATTGAATTTTGGAAGTAAGG + Intergenic
1196605927 X:117656942-117656964 CTAATCATCATTTAGAAGTATGG - Intergenic
1197187503 X:123604523-123604545 AGAATCAAGTTTGAAAAGTAAGG + Intronic
1199127170 X:144137078-144137100 AAAAACATGTTTTAGAAATATGG - Intergenic
1201468165 Y:14307935-14307957 CAAATCAAATATTAGACATATGG + Intergenic
1201862370 Y:18613105-18613127 GAAATCATATTTTAGATGTATGG + Intergenic
1201862382 Y:18613350-18613372 GAAATCATATTTTAGATGTATGG + Intergenic
1201870941 Y:18707030-18707052 GAAATCATATTTTAGATGTATGG - Intergenic
1201870953 Y:18707275-18707297 GAAATCATATTTTAGATGTATGG - Intergenic