ID: 1155558576

View in Genome Browser
Species Human (GRCh38)
Location 18:27049997-27050019
Sequence AAATCAAGTTTTAGAAGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155558571_1155558576 6 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558576 18:27049997-27050019 AAATCAAGTTTTAGAAGTATGGG 0: 1
1: 0
2: 1
3: 38
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155558576 Original CRISPR AAATCAAGTTTTAGAAGTAT GGG Intronic
902488743 1:16765316-16765338 AAAACAATTTTTAAAAGTAAAGG - Intronic
902524868 1:17049952-17049974 AAATCAGGCTTTAGAACTAGGGG - Intronic
903242753 1:21994505-21994527 ATCTCAAGTATTTGAAGTATAGG - Intronic
903725684 1:25442015-25442037 CAATCAAATTTTAGAAGCACTGG - Intronic
904372110 1:30055528-30055550 AAATCAGATTTGAGAAGTTTTGG - Intergenic
904552826 1:31334970-31334992 AAATAAAGTATTAGAACTCTTGG + Intronic
905058603 1:35120706-35120728 AAATAAATTTTTAAAAATATGGG + Intergenic
905533917 1:38703781-38703803 AAAGAATGTTTTAGAAGTAAAGG - Intergenic
907367204 1:53971964-53971986 AAATGGAGTTATAGAAGTCTAGG + Intergenic
907661619 1:56398432-56398454 AAAACAAGTTTTATATTTATTGG + Intergenic
907898349 1:58714465-58714487 AATTCAAGTTTTAAATGAATGGG - Intergenic
908706466 1:66962020-66962042 AAATCATGGTCTAGAAGTTTTGG - Intronic
909618315 1:77637963-77637985 CAATCTAGTTTTAGAAATAAGGG + Intronic
909701585 1:78530398-78530420 AAATGTAATTTTAGAAATATTGG + Intronic
909966140 1:81912993-81913015 AAATCTAGCTTTAGAACTTTAGG + Intronic
911218891 1:95226031-95226053 ATCTCAATTTTTAGAAGTATTGG - Intronic
911301577 1:96180924-96180946 CACTGAAGTTATAGAAGTATGGG - Intergenic
911715427 1:101127216-101127238 AAATAAAGACCTAGAAGTATAGG - Intergenic
911717996 1:101157237-101157259 AAATTAAGTTTAAAAAGTAAGGG + Intergenic
911955635 1:104230900-104230922 AACACAAGTTTTATATGTATTGG - Intergenic
911989703 1:104678075-104678097 TACACAAGTTTTATAAGTATTGG + Intergenic
912304468 1:108552935-108552957 AGATCAAGTTTTAGAATTAAAGG + Intergenic
912916057 1:113816038-113816060 AAATGAAATGTTTGAAGTATAGG + Intronic
913976053 1:143456616-143456638 AAATCAAATTTTAAAAGTTGAGG + Intergenic
914070450 1:144282236-144282258 AAATCAAATTTTAAAAGTTGAGG + Intergenic
914108705 1:144684118-144684140 AAATCAAATTTTAAAAGTTGAGG - Intergenic
914427329 1:147589269-147589291 AGGTCGAGTTTTAGAATTATGGG - Intronic
914758826 1:150582309-150582331 AAATAAAGTGTTGGAATTATAGG + Intergenic
914786058 1:150832144-150832166 AAGAGAAGTTTTAGAAGTTTAGG + Intronic
914891117 1:151624264-151624286 AATTCTAGTTTTAGAATTTTAGG - Intronic
916882850 1:169037179-169037201 AAATCAAATCTAAGAATTATTGG + Intergenic
917296149 1:173521626-173521648 ACATCAACTTTTAGAAATAAAGG + Intronic
917716723 1:177745721-177745743 AAATCAAGCTGTACAAGTCTAGG - Intergenic
917814105 1:178690245-178690267 AAACCAAGTGTTAGGAGTTTGGG - Intergenic
918056158 1:181023347-181023369 AAATTAAGTATTAAAAGTAGAGG - Intergenic
918558241 1:185830998-185831020 TTATCAAGTTTTTGAAGTTTTGG - Intronic
918632224 1:186731333-186731355 AAGTCAAGGTTTAGTAGTCTTGG + Intergenic
918900950 1:190416596-190416618 ACATAAATTCTTAGAAGTATAGG - Intronic
919546557 1:198928477-198928499 AAATAAAGTTTTGCAAGTATTGG - Intergenic
921215462 1:212933272-212933294 AAAGAAAGTTTTAAAATTATAGG - Intergenic
923531695 1:234817208-234817230 AAAACAATTTTTAAAAGTAAAGG + Intergenic
923911751 1:238454639-238454661 AAAACAATTTTTAAAAGTCTAGG - Intergenic
924286802 1:242495385-242495407 AAGAAAAGTTTTAGAAGAATTGG + Intronic
924363278 1:243263371-243263393 AAATCACGATCTAGAAGTACAGG + Intronic
924933862 1:248751681-248751703 AAATCAAGCCTTAGCAGGATTGG + Intronic
1063026391 10:2183093-2183115 AAATAGAGTTTTAGAATTGTAGG + Intergenic
1063702391 10:8397832-8397854 AAATAATATTTTAGATGTATTGG + Intergenic
1064851843 10:19716941-19716963 CAATCAAGTATTTAAAGTATGGG + Intronic
1064868948 10:19915823-19915845 GAATAAATTTTTAAAAGTATAGG - Intronic
1065233780 10:23625790-23625812 AACTCAAGTTAAAGAAGAATAGG - Intergenic
1065646422 10:27839189-27839211 AATTCAGGGTTAAGAAGTATTGG - Intronic
1066167289 10:32801183-32801205 AAATCTATTTCTCGAAGTATTGG + Intronic
1066542619 10:36464635-36464657 ACATCAAGTTCTAGAAATTTAGG + Intergenic
1067671453 10:48326284-48326306 AAATTAAGTATTAATAGTATTGG - Intronic
1068835167 10:61545088-61545110 AAATCATCTTTTAGAAAAATGGG + Intergenic
1072024876 10:91445460-91445482 AAAAGCAGTCTTAGAAGTATGGG + Intronic
1074261849 10:111861918-111861940 AAATCCACTTTTAGAAATCTAGG + Intergenic
1076031051 10:127158935-127158957 AAACCCAGTTCTAGAAGGATGGG - Intronic
1077729548 11:4715147-4715169 AAATATATTTTGAGAAGTATGGG - Intronic
1078481455 11:11679675-11679697 AAATCAAATTTAAGCAGGATAGG + Intergenic
1078821800 11:14890855-14890877 AAACCAATTTTTACAAGGATTGG - Intronic
1079388541 11:20001464-20001486 AACTCCAGTTTTAGATGGATGGG + Intronic
1079439052 11:20490782-20490804 AAAGGATGTTTTAGAACTATGGG + Intronic
1079566899 11:21893592-21893614 AAATGAAGTTTTATAAGTGTAGG + Intergenic
1079583814 11:22099867-22099889 TTATCAAATTTTAGAAGTTTTGG - Intergenic
1080147016 11:28998271-28998293 AATTTCAGTTGTAGAAGTATTGG + Intergenic
1081290921 11:41324488-41324510 AAAACAATTTTTAGAAACATGGG + Intronic
1082110693 11:48270608-48270630 AAATCAAGCTTTAAAAGTAAAGG + Intergenic
1082267763 11:50138165-50138187 AAATCAAGTCTAAGAAATATGGG - Intergenic
1082288327 11:50340353-50340375 AAATCAAGTCTAAGAAATATGGG + Intergenic
1083526675 11:63373232-63373254 AAATCTAGATGTAGAAGTCTAGG - Intronic
1084294760 11:68205096-68205118 AAAACAAGTTTTAAAAGACTGGG + Intronic
1084750472 11:71201648-71201670 AAAGCAAGGCTGAGAAGTATAGG + Intronic
1085799085 11:79571323-79571345 TGATAAAGTTTGAGAAGTATGGG + Intergenic
1086083185 11:82926520-82926542 AAATGACATTTTAGAAATATGGG + Intronic
1086151759 11:83619301-83619323 AAAGCAAGTTCTATAAGTTTTGG - Intronic
1087126688 11:94634934-94634956 AAATCAAGTTAAAGAATGATGGG + Intergenic
1087206336 11:95399952-95399974 AAATAAAATTTTAAAAATATTGG - Intergenic
1089925455 11:122252630-122252652 ATATCCTGTTTTAGAATTATTGG - Intergenic
1089988943 11:122839778-122839800 AAATGTAGATTTAGAAGGATAGG - Intronic
1092892755 12:12984422-12984444 GATTCAAGTTTTTGAAGTTTTGG - Intronic
1093346462 12:18041892-18041914 AAAAAAAGTTTTCTAAGTATTGG - Intergenic
1093723220 12:22470231-22470253 TAATCAACTTTTAAAAGTTTAGG + Intronic
1093731450 12:22570101-22570123 AAATCAAATTTAATAAGTATAGG + Intergenic
1093856993 12:24116935-24116957 GGATAAAGTTTTAGAAATATAGG - Intergenic
1094104740 12:26799133-26799155 GAAACCAGTTTTAGAAATATTGG - Intronic
1094231543 12:28110096-28110118 CAATTAAATTTTAGAAGTAAGGG - Intergenic
1095653257 12:44638969-44638991 AAATAATATTTTAGATGTATTGG - Intronic
1097160340 12:57041869-57041891 AAGTCAAATTTCAGAAGGATAGG + Intronic
1098719414 12:73877324-73877346 AAACCAAGTTGTAGAAGGAAGGG + Intergenic
1099952303 12:89317521-89317543 AAATACAGTTTTAAAAGTAAAGG - Intergenic
1100023788 12:90102825-90102847 TAATCAAGGTTTGGAAGTATTGG + Intergenic
1100972733 12:100088423-100088445 TAATCAAATTTTGGAAGGATGGG + Intronic
1101482190 12:105108313-105108335 AAATCAACTTTTGCAAGTTTGGG + Intronic
1101569655 12:105941448-105941470 AAAACAAGATTTGCAAGTATGGG + Intergenic
1102623704 12:114217440-114217462 AAATCAGTTTTTAAAATTATGGG + Intergenic
1105223188 13:18353136-18353158 AAATCAAATTTTAAAAGTTGAGG - Intergenic
1106325149 13:28681973-28681995 AAATTAAGTTTTGAAAGTTTAGG + Intergenic
1107166561 13:37288695-37288717 AAAACTAGTTTTAGAAGAACTGG + Intergenic
1107205736 13:37785138-37785160 AACTCAAGTTTTAGTGATATTGG - Intronic
1107367452 13:39698012-39698034 AAATCAAGTAATGGGAGTATAGG + Intronic
1108178988 13:47822414-47822436 GATTCCAGTTTAAGAAGTATAGG - Intergenic
1108275095 13:48800037-48800059 AAATTAATTTTTAAAAGTAATGG + Intergenic
1108302909 13:49097829-49097851 TAATAAAGTTTTAAAATTATAGG + Intronic
1108456241 13:50616915-50616937 AAATCCACTTTTAGAAGAAATGG + Intronic
1108542782 13:51459864-51459886 CATTCCAGTTTTAGAAATATTGG + Intergenic
1108570266 13:51742665-51742687 CCATCAAGTCTTAGAAGGATAGG - Intronic
1108600733 13:51992282-51992304 AAATAGAGTTTTGAAAGTATTGG - Intronic
1109068211 13:57728485-57728507 CAAGCAATTTTTAGAAGTTTGGG - Exonic
1109147366 13:58796513-58796535 AAAGCAATCTTTAGAAATATAGG + Intergenic
1109580484 13:64325874-64325896 AAATAAGCTTTTAGAAGAATTGG - Intergenic
1109926337 13:69145005-69145027 AAATCCATTTTCAGAAATATAGG - Intergenic
1110228650 13:73145786-73145808 CAATCAGATTTTAGAAGTCTGGG + Intergenic
1111286376 13:86098618-86098640 AAATCAAGCTTAAGCAGTCTTGG + Intergenic
1111326732 13:86706907-86706929 AAAACTATTTTTAGAAGTGTAGG + Intergenic
1111411547 13:87883443-87883465 AAATTAAGTTTTAGAAAAACAGG + Intergenic
1111549596 13:89789547-89789569 AAATCAACTTTTACATGTTTTGG - Intergenic
1112066566 13:95799363-95799385 AAATCAAATCCTAGAAGTAGTGG - Intergenic
1113209138 13:107954714-107954736 AAATGAATTTTGAGAAGTATGGG - Intergenic
1113283556 13:108818609-108818631 GAACCAAGTTTTGGAAATATTGG + Intronic
1113984753 13:114304703-114304725 TCATCAAGTTCTAGAAATATAGG + Intronic
1114823294 14:26047590-26047612 AAATGGTGTTTTAGAAGTAGAGG - Intergenic
1114843676 14:26295417-26295439 AAATCAATTTATAATAGTATGGG + Intergenic
1115101039 14:29700291-29700313 AAAACAAGTTTTAAAACTATTGG - Intronic
1115279614 14:31646830-31646852 AAAACAAATTTGAGAAGTGTTGG - Intronic
1115451816 14:33556769-33556791 AAATGAAGGTTTAGAACTATAGG + Intronic
1115902854 14:38173298-38173320 ATATCAAGTTTTTAAATTATAGG - Intergenic
1116010537 14:39346602-39346624 AAGTCAAGATTTAAATGTATTGG + Intronic
1117346082 14:54834181-54834203 AAAACAATGTTTTGAAGTATTGG + Intergenic
1118489498 14:66245178-66245200 GAATCAAGTTTTAAAAGGAGGGG + Intergenic
1119009637 14:70971442-70971464 AAAGCAAGTTTTAAAACTATAGG - Intronic
1120342636 14:83241808-83241830 GAAACAAATTTTAGAAGTAAGGG + Intergenic
1120685915 14:87537150-87537172 TAATCAAGTGTTAAAAGTCTAGG + Intergenic
1121033276 14:90677434-90677456 AAATTAAATTTTAGAAGTAATGG - Intronic
1122573145 14:102722296-102722318 AGATGAAGTTTTACAAGAATGGG + Exonic
1125070114 15:35544810-35544832 AAACAAAGACTTAGAAGTATTGG - Intronic
1125145670 15:36465289-36465311 AAATTAACTTTTATAAGTGTAGG - Intergenic
1126905147 15:53356953-53356975 CACTCAAGTTTTAGAACTACTGG - Intergenic
1127027258 15:54820577-54820599 ACAATATGTTTTAGAAGTATAGG - Intergenic
1127110296 15:55662123-55662145 AAAAAATGTTTAAGAAGTATAGG + Intronic
1128436501 15:67655756-67655778 AAATCAAATTTAGGAAGTTTGGG + Intronic
1129122815 15:73412495-73412517 AAATCAAATTTCAGATGGATCGG + Intergenic
1130375185 15:83322685-83322707 AAGTCAAGTTTCAGAAGAAAAGG - Intergenic
1130399061 15:83532244-83532266 AATTGAAGTTTGAGAAGTTTGGG + Intronic
1133147434 16:3800008-3800030 AAATTAAATTGTAAAAGTATGGG + Intronic
1137342844 16:47627004-47627026 AAACCAGGTTTTAGAATCATGGG - Intronic
1143458554 17:7084361-7084383 AAATCAGGCTTTAGAAGGACAGG - Intergenic
1145193111 17:20864929-20864951 TAATAAAATTTTAGAAATATAGG - Exonic
1145227202 17:21139769-21139791 AAAGCAAGTTTTAAAATTATTGG - Intronic
1145298905 17:21616164-21616186 TAATAAAATTTTAGAAATATAGG + Intergenic
1145351375 17:22087122-22087144 TAATAAAATTTTAGAAATATAGG - Intergenic
1145403524 17:22566927-22566949 TAATAAAATTTTAGAAGCATAGG - Intergenic
1145723394 17:27092910-27092932 TAATAAAATTTTAGAAATATAGG + Intergenic
1146478563 17:33183173-33183195 AAAGTAAGTTCTAAAAGTATTGG + Intronic
1147275935 17:39316679-39316701 AACTGAAGTTTAAGAAGAATGGG + Intronic
1149379619 17:56080597-56080619 GCATCAAGTCTTAGGAGTATAGG - Intergenic
1150891729 17:69159398-69159420 AAAACAAATTTTGGAAGTTTTGG - Intronic
1152958857 18:64863-64885 ATATTAAGTATTAGAAGTTTAGG - Intronic
1153128263 18:1822848-1822870 AAATCAATTTTTAAAAATGTGGG + Intergenic
1153722503 18:7921206-7921228 ATATCAAATTTAAGAATTATTGG - Intronic
1153864234 18:9248366-9248388 AAATAAGGTTTTAAAATTATGGG - Intronic
1154107789 18:11538105-11538127 AAATACAGTTTTAAAATTATTGG + Intergenic
1154940457 18:21108229-21108251 AAATGTTGTTTTAGAAGTGTTGG + Intronic
1155061654 18:22233919-22233941 AAGGCAATTTTTACAAGTATAGG - Intergenic
1155558576 18:27049997-27050019 AAATCAAGTTTTAGAAGTATGGG + Intronic
1156675928 18:39527424-39527446 AAATAAACTCTTAGAAGTTTAGG - Intergenic
1157229624 18:45902705-45902727 AACTCACTATTTAGAAGTATAGG + Intronic
1157983851 18:52414971-52414993 AAATGCAGTTTCAGAAGTGTAGG + Intronic
1158233216 18:55282496-55282518 CAATCAAGCTTTCAAAGTATGGG + Intronic
1158465385 18:57685629-57685651 AAATCAACTTTTAAAACAATTGG + Intronic
1166418675 19:42616198-42616220 AAATATAGTTTTAAAATTATTGG + Intronic
925488382 2:4362982-4363004 AAGTCAAATTTAACAAGTATTGG - Intergenic
926237876 2:11061322-11061344 AAATAAAGTGTTACAAGTTTAGG + Intergenic
926445743 2:12940587-12940609 ATTTCTAGTTTTAGTAGTATAGG + Intergenic
927579436 2:24228875-24228897 AAATCAGGTCATAGAAGTGTTGG + Intronic
927814520 2:26202757-26202779 AAATAAGGTCTTAAAAGTATGGG + Intronic
928963061 2:36949431-36949453 AAATCAATTTTTAGAAGCCTGGG + Intronic
929389840 2:41457339-41457361 AAAAAAAGTGTTAGAAATATAGG - Intergenic
929845882 2:45526804-45526826 AAATCAAGTTATAGAAGATTAGG + Intronic
929859478 2:45664282-45664304 AAATCTAGTTTTATCAGTTTTGG + Intronic
930282202 2:49383155-49383177 TAATCATGTTTTAGAATCATGGG - Intergenic
930462928 2:51706980-51707002 TAATTAAGATTTAGAAGAATAGG - Intergenic
930983953 2:57562070-57562092 AAGTCAAGTTTGAGTACTATAGG - Intergenic
931333403 2:61313452-61313474 AGAAAAAATTTTAGAAGTATGGG + Intronic
931553767 2:63476807-63476829 AAATCAAGTTCTACAATTAAGGG + Intronic
932512299 2:72305296-72305318 AAATTAAGTTGAAGAAATATGGG + Intronic
932904229 2:75732690-75732712 AAATCAATTTTTAAAAAGATAGG - Intergenic
933467914 2:82679597-82679619 AAATAAAGTCCTAGAAGTAGAGG + Intergenic
933561955 2:83898754-83898776 TAATCTATTTTTAAAAGTATTGG - Intergenic
934017314 2:87901468-87901490 AAAACATGTTTTAGAAATATGGG + Intergenic
934180752 2:89617607-89617629 AAATCAAATTTTAAAAGTTGAGG + Intergenic
934291051 2:91691843-91691865 AAATCAAATTTTAAAAGTTGAGG + Intergenic
935652903 2:105397839-105397861 GCATCAAGTCTTAGAAGTACAGG - Intronic
935963682 2:108451097-108451119 AAATCAAGGTGTACAGGTATTGG + Exonic
936672689 2:114676565-114676587 CAACCAAGTTTTAGAAGCACTGG - Intronic
937479871 2:122246714-122246736 AAAATAAGTTTGAGAAGTAGAGG - Intergenic
939631426 2:144530392-144530414 AAATTAAGCTTTAAAAGAATGGG - Intergenic
939643863 2:144672371-144672393 AAATCCTGTTTTAGAAGTTGGGG + Intergenic
941015522 2:160351392-160351414 AAATCACAATTTAAAAGTATTGG - Intronic
941283606 2:163582168-163582190 AAATCAAGTCTTAGGAAAATGGG + Intergenic
941462372 2:165786995-165787017 AAATCTATTTTTAAAAATATGGG + Intronic
942328861 2:174800575-174800597 AAATGTAGGTTTAGAACTATAGG - Intronic
942914662 2:181290752-181290774 AAATAAAGTTGTAAAAGTAATGG - Intergenic
943487521 2:188505022-188505044 AAATAAATTTTTGGAAGTAGTGG + Intronic
943617386 2:190109169-190109191 CAATCAAGAGTTAGAATTATAGG + Intronic
943872791 2:193023261-193023283 ATGTAAAGTTTTACAAGTATTGG + Intergenic
944140513 2:196451128-196451150 AAAGCAAGCTTAAGAAATATGGG + Intronic
944342238 2:198615151-198615173 AAATGAATTTTTAGAAATTTGGG + Intergenic
945480449 2:210338869-210338891 AAATCAAATATTAGAATTAGAGG - Intergenic
947060220 2:226156030-226156052 ACATTATATTTTAGAAGTATTGG - Intergenic
948401363 2:237688067-237688089 AAATCCATTCTCAGAAGTATAGG - Intronic
948401716 2:237690286-237690308 AAATCAAGTCTCAGAAGAAGAGG + Intronic
1169944393 20:10973429-10973451 AAAACAAGTTTTAGAATTACAGG + Intergenic
1170327585 20:15174076-15174098 AAATCATGATTTAAAAGTCTTGG - Intronic
1170652931 20:18259307-18259329 CAATCAAGATTTATAAGTATAGG + Intergenic
1170927376 20:20737787-20737809 AAATCATGTCTTAAATGTATAGG + Intergenic
1171561622 20:26132081-26132103 TAATAAAATTTTAGAAATATAGG - Intergenic
1172377479 20:34456507-34456529 AAATCAAGTTGTACAAGTTGTGG + Intronic
1172975324 20:38901724-38901746 AAATGCAGTTATAAAAGTATAGG + Intronic
1173278971 20:41610364-41610386 AAATCAATTTTTAAACATATTGG + Intronic
1175680553 20:60985331-60985353 AAATTAAGCTTTAGCATTATTGG - Intergenic
1176649632 21:9533221-9533243 TAATAAAATTTTAGAAATATAGG + Intergenic
1176731738 21:10505554-10505576 AAATCAAATTTTAAAAGTTGAGG - Intergenic
1177311099 21:19394222-19394244 AATTCAAATTATAGAAGTCTTGG + Intergenic
1177524269 21:22271775-22271797 ATATCACCTTTAAGAAGTATAGG + Intergenic
1177545706 21:22555795-22555817 AGATCAAGTTTTAAAAATTTAGG + Intergenic
1181119399 22:20655595-20655617 AAATACAGTTTTAAAATTATTGG - Intergenic
1182758583 22:32702175-32702197 AAATAAAGTAATAGAAGCATCGG + Intronic
1184077652 22:42193025-42193047 CAAGAAAGTTTTAGAACTATTGG + Intronic
949859179 3:8490264-8490286 AAATTAAGCTTTAAAAGTTTTGG - Intergenic
949994572 3:9606443-9606465 AAATAAATTTTAAGAACTATAGG - Intergenic
950036803 3:9891869-9891891 AAATCTAGCTGGAGAAGTATGGG + Intronic
950589480 3:13926009-13926031 TAATCAGGGTTTAGATGTATAGG + Intergenic
950732177 3:14970210-14970232 AAATCAAGAATTAGAAATAGTGG - Intronic
950988830 3:17408621-17408643 ATATTAATTTTTAAAAGTATAGG - Intronic
951055664 3:18143848-18143870 AAAACAATTTTTTGATGTATTGG + Intronic
951819980 3:26797596-26797618 CAATAAAGTTCTAGAAGCATTGG - Intergenic
952120982 3:30244238-30244260 AAATTAAGTTTTAGAGGGGTTGG - Intergenic
952142210 3:30492595-30492617 AAATCTTGATTTAGAAGGATTGG + Intergenic
955131799 3:56177034-56177056 AAATGATGTTTCAGAAGTGTGGG - Intronic
955862282 3:63344429-63344451 TTATAAAGTTTTAGAAATATAGG + Intronic
956258802 3:67314205-67314227 AAACCAACTTTTAGAAGACTAGG - Intergenic
956427106 3:69147505-69147527 AAATAAATTTTTAAAAGTAGAGG + Intergenic
956469220 3:69548085-69548107 AAATCTATTTTTAGAAATAATGG - Intergenic
956928199 3:74012353-74012375 AAATTAAGTTTTATAAATACTGG + Intergenic
958150887 3:89693168-89693190 AAATCAAAATTTTAAAGTATTGG - Intergenic
959128580 3:102322061-102322083 AAATTAAGTTTTCTAAGTGTAGG - Intronic
959430278 3:106246064-106246086 AAATCAACTTTTACTAGAATCGG + Intergenic
959803056 3:110518351-110518373 AAATCAATGTTTGGAAGTTTAGG + Intergenic
960274651 3:115714652-115714674 AAATTTAGTTTTAGTAGTTTAGG - Intronic
961436671 3:126923714-126923736 AAAACAACCTTTAGAAGTAAGGG - Intronic
963242913 3:143027729-143027751 GAATAAAGTTGTAAAAGTATGGG + Intronic
963368229 3:144365938-144365960 AAATGCAGTTTTAGAATTAGTGG + Intergenic
963380683 3:144526111-144526133 AAATCATGTTTTAAAAATATTGG - Intergenic
963708431 3:148717941-148717963 AAAACAATTTTTAAAAGGATTGG + Intronic
963986871 3:151606481-151606503 AAGTCATGTTGTAGAAATATGGG - Intergenic
964547104 3:157846463-157846485 AGATTAAGTTTTATAAGTTTGGG - Intergenic
965207608 3:165742363-165742385 AAATCTAATTTTTTAAGTATTGG - Intergenic
965925272 3:173971347-173971369 AAATCAAGTTTCAGTGGAATAGG + Intronic
966171776 3:177089688-177089710 AAATTAATTTTTAGAAGTTGTGG + Intronic
966576492 3:181508720-181508742 AAATGAATTTTTAGTATTATTGG + Intergenic
966576501 3:181508892-181508914 AAATGAATTTTTAGTATTATTGG + Intergenic
967131302 3:186473172-186473194 GAACCACATTTTAGAAGTATAGG + Intergenic
967646606 3:191931421-191931443 AAATTTAGTATTAAAAGTATAGG - Intergenic
967903242 3:194478600-194478622 AAATGGAGGTTTAGAAGGATAGG + Intronic
970261837 4:14233036-14233058 AAATCAAAGTTTTAAAGTATTGG - Intergenic
970748007 4:19322688-19322710 AAGTGAAGTATTAGAAATATAGG + Intergenic
970930060 4:21499828-21499850 AAGTCAGCTTTTTGAAGTATTGG - Intronic
971577155 4:28289926-28289948 AAATGAAGTTTTAGTTGGATAGG + Intergenic
971764226 4:30808657-30808679 AAAACAAATTGTAGAAATATAGG + Intronic
971846647 4:31927164-31927186 AAATCAATATGCAGAAGTATTGG - Intergenic
972029872 4:34441230-34441252 ACATCAAGATTTAGAAGTGTTGG - Intergenic
972274732 4:37546613-37546635 ACACCAAGTTTTAGAAGGAAGGG - Intronic
972445756 4:39142210-39142232 AAATCAATTTTTAAAAGAAAAGG - Intergenic
973654979 4:53037240-53037262 AAAGCAAGTTGTAGAAGTTTAGG + Intronic
974361473 4:60886340-60886362 AAATCAAGTTTGAGGAGGCTGGG - Intergenic
974386838 4:61211566-61211588 AAGTCAGGTGTTAGAAGAATTGG + Intronic
974423058 4:61703576-61703598 AAATGAAGTATTAGAACAATAGG + Intronic
974915198 4:68171088-68171110 AAAGCTACTTTTAGAGGTATGGG + Intergenic
975170810 4:71230118-71230140 AAATCATGTTTAAGAAGTGGGGG - Intronic
975204894 4:71634236-71634258 AAATCTAGTTTTACAAGAAAAGG + Intergenic
975288976 4:72654159-72654181 AGATAAAATTTTAGAAATATTGG - Intergenic
976480855 4:85543269-85543291 AACACATGTTTCAGAAGTATCGG + Intronic
976828078 4:89282727-89282749 AAATCACTTGTCAGAAGTATGGG + Intronic
976979912 4:91215002-91215024 TAATAAAGTTTTAGAAGTTAAGG + Intronic
977270160 4:94908376-94908398 AAATAAAGTTTAAGAAGGACAGG - Intronic
977405506 4:96592706-96592728 AAATAAAGTATTAGCAGGATGGG + Intergenic
977491419 4:97717096-97717118 AAATCTAGTCTTAGAGGTAGTGG - Intronic
977816982 4:101426364-101426386 AAATAATGATTTTGAAGTATTGG + Intronic
978374670 4:108062245-108062267 AAATTAAGTTCTAAAAGTTTAGG + Intronic
978981150 4:114947189-114947211 AAATTTAGTTTCAGTAGTATAGG + Intronic
979062795 4:116086103-116086125 AAATTATGATTTAGAATTATCGG - Intergenic
979173856 4:117637207-117637229 AAAGCAAAGTTTTGAAGTATTGG + Intergenic
979614108 4:122722218-122722240 AAATCAAGTCATGTAAGTATGGG + Intergenic
979717249 4:123854936-123854958 CAATGAATTTTTACAAGTATTGG + Intergenic
980032587 4:127847470-127847492 AAACCAAGTTTTATAAGTGAAGG + Intergenic
980794314 4:137661393-137661415 AAATCAAGTTTTATAAAATTAGG - Intergenic
980892071 4:138826410-138826432 AAATAAAGTTTTAGAAAATTAGG + Intergenic
980922286 4:139098766-139098788 AAATTAAGTTTTAAAAATATCGG - Intronic
981368794 4:143934188-143934210 AAAAGAACATTTAGAAGTATAGG + Intergenic
981378593 4:144044442-144044464 AAAAGAACATTTAGAAGTATAGG + Intergenic
981511182 4:145560541-145560563 AAATCAACTATTAGAAGTGGAGG + Intergenic
982470895 4:155788707-155788729 AAATAAAGTCTTAGAAAAATTGG + Intronic
982940953 4:161553769-161553791 AAATCATATTTTAAAAGTAAAGG + Intronic
983299141 4:165902870-165902892 TAAACAAGTTTTAGAACTTTAGG - Intronic
983868141 4:172792455-172792477 AAATGAAGTCCTGGAAGTATGGG + Intronic
984395833 4:179198936-179198958 AAATCAAGTGTTTGGATTATAGG - Intergenic
984784657 4:183556373-183556395 AAATAAAATTTAAGAAGTATAGG - Intergenic
985051557 4:185997192-185997214 AAATCAAGTTATCAAAATATTGG + Intergenic
985137652 4:186803236-186803258 TAATAAAGTTTGAGAAGTGTAGG - Intergenic
985892757 5:2728703-2728725 AAATGCAGTTTTTGAAATATTGG + Intergenic
986782607 5:11080772-11080794 AAATGAATTTATAGAAGCATAGG + Intronic
987512681 5:18860665-18860687 AAATTAAGTTTAAGAATTTTAGG + Intergenic
987801547 5:22703134-22703156 AAATAAAGTTTTGGAAATGTTGG - Intronic
988167988 5:27618780-27618802 AAATAAAATTTTAGAGCTATAGG - Intergenic
988884178 5:35537294-35537316 AAATAATGTTTTTGAAGTAAGGG + Intergenic
989202416 5:38777031-38777053 ATCTGAAGTTTTAGAATTATTGG + Intergenic
989716967 5:44475608-44475630 AAATAAAGTTTTAAAATTGTTGG - Intergenic
989799678 5:45522101-45522123 AAATCAAGGTTTCTAACTATAGG - Intronic
990210057 5:53472875-53472897 AAAGCAAAAATTAGAAGTATTGG + Intergenic
990585964 5:57211486-57211508 AAATCTAGTTCTTAAAGTATGGG - Intronic
990733880 5:58838843-58838865 AAAGCAAGTATTAGATGTAAAGG - Intronic
991212419 5:64120982-64121004 AGATAAAGTTGTAGAAGTAGAGG + Intergenic
991347922 5:65689911-65689933 AAATTAAGATTTGAAAGTATAGG + Intronic
991903434 5:71482918-71482940 ATATCAGGTTTTAAAAATATGGG + Intronic
992072817 5:73164214-73164236 AAATGAAGTTTGAGAATTAAAGG + Intergenic
992256165 5:74923245-74923267 AAATAAAGTTTCAGAAATAGTGG - Intergenic
992696219 5:79290685-79290707 AAATTATGTTTTAGAAATGTCGG + Intronic
993423858 5:87737738-87737760 AAATCAATTTTTATAAGAGTCGG + Intergenic
993566325 5:89480430-89480452 AACTCTAGTTTTAGTAGAATGGG - Intergenic
993573841 5:89577057-89577079 AAATCAAGTTTTACATATTTTGG - Intergenic
994015846 5:94964246-94964268 AAACAAATTTTAAGAAGTATAGG - Intronic
994404327 5:99324893-99324915 AAAAAAACTTTTAGAAGTCTGGG + Intergenic
994810594 5:104513653-104513675 CAATCAAGTTTTAGAACTATTGG - Intergenic
996261250 5:121472164-121472186 AAATAATATTTTTGAAGTATTGG - Intergenic
997146151 5:131435558-131435580 AATTCAAGTTTATGAAGTCTGGG + Intronic
998907832 5:146925684-146925706 AAATCAAATTTTGGAAGTTTTGG + Intronic
999132981 5:149298916-149298938 CACTCAAGTTTGAGAAGCATTGG + Intronic
999537951 5:152539002-152539024 AAATTAATTCTTAGAAGTACAGG - Intergenic
1000021963 5:157325944-157325966 AAATGAATTTTTACAAGTCTTGG + Intronic
1003470278 6:6423145-6423167 AAGTGAAATTTTAGAAGAATAGG + Intergenic
1003740393 6:8930563-8930585 AAATCCAGTGTTAAAAATATTGG - Intergenic
1003799871 6:9651729-9651751 AAATGAGGTCTTAGAAGTAAAGG + Intronic
1005138509 6:22599704-22599726 AAATCAAATTCTATAAGTAAAGG + Intergenic
1005333822 6:24773845-24773867 AAATCAAGCTTTCTCAGTATGGG - Intergenic
1006767096 6:36516578-36516600 AAATCATATTTTTTAAGTATTGG - Intronic
1007169838 6:39855107-39855129 AAATTAAGATCTATAAGTATGGG + Intronic
1007799459 6:44379656-44379678 AAATACAGTTTTAGAAGGTTTGG + Intergenic
1008401099 6:51064035-51064057 AAACATAGTTTTAGAAGGATTGG + Intergenic
1008594228 6:53025131-53025153 AAATCAAGATTTAGCTATATGGG - Intronic
1009441132 6:63679958-63679980 AAATTAACTTTTAAAAATATTGG - Intronic
1009495988 6:64346868-64346890 TAATCAAAATTTAGAAGTGTAGG - Intronic
1012073501 6:94654287-94654309 AATTCATGATTTAGAAATATAGG + Intergenic
1012522039 6:100133579-100133601 AAATTAAGCTTTTGAATTATCGG - Intergenic
1012570349 6:100718402-100718424 AAATCAAGCTTGTGAATTATGGG - Intronic
1014021822 6:116599682-116599704 AAATCAAGTTGAAGATGCATGGG + Intergenic
1014061507 6:117077326-117077348 AAAGCAAGCTGTAGAAGGATTGG + Intergenic
1014293545 6:119589678-119589700 GTATGAAGTTTTAGAAGTTTTGG + Intergenic
1014969241 6:127793362-127793384 AAATCAGGTTTTGGAAGTGCAGG + Intronic
1015205521 6:130633670-130633692 AAATCCATTTTTAAAAGTACAGG + Intergenic
1015659938 6:135564489-135564511 AAACCAAGTTTCAGAAGCAAAGG - Intergenic
1016271139 6:142292001-142292023 TAATCAATTGTTAGAAATATCGG - Intergenic
1017116300 6:150980145-150980167 AAATCAAGGTTGAGAAGTGCTGG + Intronic
1018660206 6:166079008-166079030 AAATCAAAATCTAGAAGTGTGGG + Intergenic
1019067777 6:169316898-169316920 AAATAAAGTATTCGAAGTCTTGG + Intergenic
1020572409 7:9882230-9882252 AAATTAAGTTTTAAAGGTATAGG - Intergenic
1020595218 7:10198726-10198748 AATTCAAGTTTTAAAAATATGGG + Intergenic
1020887560 7:13837053-13837075 AAGTCAAGATTTAAAAATATTGG + Intergenic
1020926717 7:14336882-14336904 GAATCAATTTGTATAAGTATCGG + Intronic
1021928350 7:25554556-25554578 AGATAAAGATTTAGAACTATAGG + Intergenic
1022404895 7:30079594-30079616 AAAGCAAGGTTTAGAAGTTGAGG + Exonic
1022779219 7:33561038-33561060 AAAGCAAGTTTTAAAAGGAAGGG - Intronic
1022823171 7:33981274-33981296 AAATAAAGTTTGAGAAGCACTGG + Intronic
1023712414 7:43009096-43009118 AAATCAAATTTTAGAACTAGAGG + Intergenic
1025271063 7:57517405-57517427 ACATCAAGATTTAGAAGTGCTGG + Intergenic
1025294613 7:57766358-57766380 AAATAAGGTTTTACAAATATAGG + Intergenic
1027394166 7:77736860-77736882 AAAGCAAGTTTTAGTATGATAGG + Intronic
1027522196 7:79223256-79223278 AAATGGATTTTTAAAAGTATTGG + Intronic
1027762278 7:82295100-82295122 AAATGAAGTATTGGAAATATAGG - Intronic
1028472597 7:91221187-91221209 TAATCAAATTTTAAAAGTGTTGG - Intergenic
1031151465 7:118059078-118059100 AAATCAATTTGAAAAAGTATAGG + Intergenic
1031218024 7:118922754-118922776 AAAGCTAGTTTTAAAATTATTGG + Intergenic
1031877770 7:127161419-127161441 GAATCAATTTGTAGGAGTATAGG - Intronic
1033481889 7:141750742-141750764 AAATCAATATTTACAAATATGGG - Intronic
1034597852 7:152215915-152215937 AAATCAAATTTTAAAAGTTGAGG + Intronic
1036037501 8:5035364-5035386 AAAGCAAGATTTAGAAATCTAGG - Intergenic
1036096489 8:5729974-5729996 AAATCAATTTTTATAAGATTAGG + Intergenic
1036789107 8:11706039-11706061 AAATAAAGTTAAAGAATTATGGG - Intronic
1037100258 8:15034477-15034499 AGATCAAGTGTTAGAGTTATAGG + Intronic
1037209173 8:16364079-16364101 AAATCAATTTTTAAAAGTTTGGG - Intronic
1037369346 8:18157891-18157913 AAATTCACTTTTAGAAGTTTTGG + Intergenic
1037465967 8:19160932-19160954 AAATCAAGTTCTAGCATTTTAGG - Intergenic
1038008239 8:23452283-23452305 AAGTCAAGTTTTAGAGTTCTGGG + Intronic
1038380969 8:27093478-27093500 ACATCAGCTTTTTGAAGTATTGG - Intergenic
1038863188 8:31409792-31409814 AAATTATGTTTTAAAAATATGGG + Intergenic
1040019666 8:42729477-42729499 AAACAAAGTTTAAGATGTATGGG - Intronic
1040819118 8:51535741-51535763 AAATAAAGTTTGAGAAGAACTGG + Intronic
1042378519 8:68084006-68084028 AACTAAAGTTTTTAAAGTATTGG + Intronic
1042954597 8:74236222-74236244 AAATAACCTTTTACAAGTATAGG + Exonic
1043005386 8:74811822-74811844 AAATCAGGTTTAAGAAGGTTAGG + Intronic
1043194205 8:77269944-77269966 AAAGTGATTTTTAGAAGTATAGG + Intergenic
1044687505 8:94841332-94841354 TAATCAAATTTTAGAATTTTAGG + Intronic
1044819592 8:96146522-96146544 CAATGAAGTTTCAGAAGTATTGG + Intronic
1045257498 8:100540445-100540467 AAAATAAGTTTTTAAAGTATGGG + Intronic
1046082239 8:109384547-109384569 AAATCAATTTTTTAAAATATTGG - Intronic
1046241300 8:111497888-111497910 TTATCAGTTTTTAGAAGTATAGG - Intergenic
1047639894 8:126807326-126807348 AAATAATTTTTTAAAAGTATTGG - Intergenic
1047879352 8:129176543-129176565 AAATCAATTTTTGGAAGGATGGG + Intergenic
1047981817 8:130191290-130191312 AAATCAAGTTTTAGTAGGTGTGG + Intronic
1048808836 8:138266365-138266387 ATATCAAGTTTTAAAGGAATTGG + Intronic
1048897203 8:139002516-139002538 AGATCAAGTTTTAGGAGACTGGG + Intergenic
1049803657 8:144529380-144529402 AAATTAAGTTTTACAACAATTGG + Exonic
1050331099 9:4547018-4547040 AAAACAGGTTTTAGAAGAAAAGG + Intronic
1050854888 9:10341056-10341078 ACATTAATTTTTAAAAGTATTGG + Intronic
1052190768 9:25658813-25658835 GAGTCAAGTTTTATAAGCATAGG - Intergenic
1054708745 9:68489326-68489348 AAATCCAGTTTTCAAAATATAGG - Intronic
1055169891 9:73243392-73243414 AAATAAAGGTTTTGGAGTATTGG + Intergenic
1055660520 9:78499021-78499043 AATTCAAATTTTAGAAATTTTGG - Intergenic
1057537471 9:95926834-95926856 ACATCAAGTATTATTAGTATTGG - Intronic
1057851471 9:98570052-98570074 AAATCAAGTCCTAAACGTATTGG + Intronic
1059129205 9:111727363-111727385 AAAGCAAGTTTTACAAATAGTGG + Intronic
1060310648 9:122457644-122457666 AAATCAACTTTAAAAAATATGGG + Intergenic
1203627373 Un_KI270750v1:36769-36791 TAATAAAATTTTAGAAATATAGG + Intergenic
1187394078 X:18905167-18905189 AAAAAAAGTGTTAGAAGTGTGGG - Intronic
1188668132 X:32850318-32850340 AACTCAAATTTTAGGAATATCGG + Intronic
1188738841 X:33752148-33752170 CAATAAAGTATTAGAAGTTTTGG - Intergenic
1189196477 X:39157980-39158002 TAATCAAGTGTTAGAAATCTGGG - Intergenic
1191055618 X:56237065-56237087 CAATCAACTTTTAAAAGTGTGGG + Intronic
1191157295 X:57287425-57287447 AAATCAATTTTAAAAAGAATTGG - Intronic
1191636449 X:63382771-63382793 AACCCAAGATTTAGAAGAATAGG + Intergenic
1193270479 X:79523988-79524010 AAAAGAAGTTTTAGAACTCTTGG + Intergenic
1194267384 X:91771566-91771588 AAATCTGGTTTTGGAAGTGTGGG + Intergenic
1194822029 X:98521520-98521542 AAATCAACTATTTGAAGTAATGG + Intergenic
1195860042 X:109373833-109373855 AAACCAGGTTTGAGAAGTAGTGG + Intronic
1196315518 X:114218051-114218073 AAATTAAGTTTTATGAGTTTAGG + Intergenic
1196587407 X:117445318-117445340 AAATCAAGCTTTATAAGTGAAGG + Intergenic
1197530899 X:127624969-127624991 AAATAAAGTGTGTGAAGTATGGG + Intergenic
1197617674 X:128713153-128713175 AAATCAAGTCTTTTGAGTATTGG - Intergenic
1199127169 X:144137077-144137099 AAAACATGTTTTAGAAATATGGG - Intergenic
1199148776 X:144404215-144404237 AACTTAAGTTTTAGAAATATAGG + Intergenic
1199315326 X:146370484-146370506 AAATAAAATTTTAAAATTATTGG - Intergenic
1199373222 X:147075900-147075922 ACATAAAGCTTTAGAAATATTGG - Intergenic
1200584589 Y:4992503-4992525 AAATCTGGTTTTGGAAGTGTGGG + Intergenic
1201632693 Y:16086821-16086843 AAATAAAATTTTAGAAGAGTAGG + Intergenic
1201862371 Y:18613106-18613128 AAATCATATTTTAGATGTATGGG + Intergenic
1201862383 Y:18613351-18613373 AAATCATATTTTAGATGTATGGG + Intergenic
1201863814 Y:18628110-18628132 AAATCATATTTTGGATGTATTGG + Intergenic
1201869508 Y:18692268-18692290 AAATCATATTTTGGATGTATTGG - Intergenic
1201870940 Y:18707029-18707051 AAATCATATTTTAGATGTATGGG - Intergenic
1201870952 Y:18707274-18707296 AAATCATATTTTAGATGTATGGG - Intergenic