ID: 1155558577

View in Genome Browser
Species Human (GRCh38)
Location 18:27049998-27050020
Sequence AATCAAGTTTTAGAAGTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155558571_1155558577 7 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558577 18:27049998-27050020 AATCAAGTTTTAGAAGTATGGGG 0: 1
1: 0
2: 2
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155558577 Original CRISPR AATCAAGTTTTAGAAGTATG GGG Intronic
902524867 1:17049951-17049973 AATCAGGCTTTAGAACTAGGGGG - Intronic
903089207 1:20895019-20895041 AATGAACTTTTAGAACAATGAGG + Intronic
904058591 1:27688470-27688492 AATAAAGCTATAGAAGTATTTGG - Intergenic
904899770 1:33847660-33847682 AATTCAGTTATAGAAGTGTGTGG + Intronic
905058604 1:35120707-35120729 AATAAATTTTTAAAAATATGGGG + Intergenic
906814684 1:48866849-48866871 AAATAAGTTTTAGAATCATGTGG - Intronic
907610347 1:55863303-55863325 AAAGAAGTTTTAGAAGTACATGG + Intergenic
908393391 1:63703500-63703522 AATCAAGTTTGAGAATGCTGTGG - Intergenic
908694729 1:66825729-66825751 AATCAAGGATTACAAGTATGAGG - Intronic
908742687 1:67344648-67344670 AATCAATTTTTAAAATTATTTGG + Intronic
908985470 1:70013897-70013919 AATCAGATTTTAGAAGTTTCAGG + Intronic
909222106 1:72978529-72978551 AAGCATGTATTAGAAGTTTGAGG + Intergenic
909855105 1:80519658-80519680 AACCAAGTTTAAAAACTATGAGG - Intergenic
910147058 1:84092729-84092751 CATCAAGTTTGGGAAGGATGTGG - Intronic
911218890 1:95226030-95226052 TCTCAATTTTTAGAAGTATTGGG - Intronic
912151527 1:106864518-106864540 CCTCAAGTTTTAGAAGAATTAGG + Intergenic
912561278 1:110553338-110553360 ATTCAAGGGTTAGAAGTAGGAGG + Intergenic
913374997 1:118141382-118141404 AATCAAGTTTTAAAAAAATAAGG + Intronic
917758426 1:178128193-178128215 AATCAATTTTTTGAATTCTGAGG - Intronic
918594255 1:186274636-186274658 AAATAAGTTTCAGAAGGATGAGG - Intergenic
918753621 1:188306765-188306787 AATCAAGTTTAAGAAGATTTTGG + Intergenic
918763182 1:188441609-188441631 ACTCAAGTTTAGGAAGGATGAGG - Intergenic
919528908 1:198691054-198691076 AATCAAATTTTCCAAGTAAGAGG - Intronic
920783110 1:209013752-209013774 AATAAGGTTTTAAAAGCATGAGG + Intergenic
921506840 1:215982144-215982166 AACCAAGTTTTAAAGGTACGTGG - Intronic
924124865 1:240839934-240839956 AATCAAGTGTGGGAAGTAAGGGG - Intronic
1063273192 10:4535148-4535170 ACTTGAGTTTTAGAAGTAGGTGG + Intergenic
1063738385 10:8788981-8789003 AATCAAGTTTTGGGTGAATGTGG + Intergenic
1063754859 10:8995814-8995836 AATCTAGTACTAGAATTATGTGG - Intergenic
1063780045 10:9312191-9312213 AATAAAGCTGTAGAAGAATGTGG + Intergenic
1064214022 10:13384407-13384429 AATGAAGTTTTAGAAGCAGATGG + Intergenic
1064731747 10:18338471-18338493 AATCAAGTTTTGGAACTTTAAGG - Intronic
1064851844 10:19716942-19716964 AATCAAGTATTTAAAGTATGGGG + Intronic
1064868947 10:19915822-19915844 AATAAATTTTTAAAAGTATAGGG - Intronic
1068176170 10:53462284-53462306 TATCAAGTTTAGAAAGTATGTGG + Intergenic
1068189022 10:53625825-53625847 AATTAGGTTTTAGAAGTTTATGG - Intergenic
1068353010 10:55873767-55873789 AATTAGGTTTTAGAATTGTGTGG + Intergenic
1069179351 10:65337230-65337252 AAGCTAGGTTTAGAAATATGGGG + Intergenic
1070149810 10:73798736-73798758 ATTCAAGTCTTAGATGTATGAGG - Intronic
1070208757 10:74292467-74292489 AATCATGTTTGAGAAGTTAGGGG + Intronic
1071919226 10:90330581-90330603 AAGCCAGTATTAGCAGTATGTGG + Intergenic
1071919639 10:90335020-90335042 ATTCTAGTTTTAGATCTATGAGG - Intergenic
1073702976 10:105951193-105951215 AATCAACTTTGAGAAGCATAAGG - Intergenic
1074431086 10:113395280-113395302 AATACAGTTTGAGAAGTGTGGGG + Intergenic
1075481926 10:122789587-122789609 ACTCAAGATTCTGAAGTATGTGG + Intergenic
1078289426 11:9993516-9993538 AATCAAGTTTGAAGAGTCTGTGG - Intronic
1078292943 11:10032967-10032989 AACCAAGTATTAGATGTCTGTGG + Intronic
1078995203 11:16690495-16690517 AATCTAGTTTTAATAGTATAAGG + Intronic
1079065711 11:17289619-17289641 AAGCATTTTTAAGAAGTATGGGG - Intronic
1079210747 11:18458450-18458472 ATTCAAGTTCTAGAAGCAGGAGG - Intronic
1079566900 11:21893593-21893615 AATGAAGTTTTATAAGTGTAGGG + Intergenic
1080000446 11:27342615-27342637 AATGAAGTTTTATAGGAATGTGG + Intronic
1080168803 11:29273554-29273576 AAGCACGTTTTAGTAGTATTTGG + Intergenic
1080795759 11:35561711-35561733 AATTTAGTTTTAGAATTAGGTGG - Intergenic
1080964477 11:37198045-37198067 AATCAGGTTTTAGAAGGCTATGG - Intergenic
1081827901 11:46075748-46075770 AATAAACTTTGAGAATTATGTGG - Intronic
1082913986 11:58410829-58410851 AATCAAGTTTGGGAAGTTAGTGG - Intergenic
1082953441 11:58843248-58843270 AATCACTTTTTAGCAGTAAGTGG + Intronic
1082969841 11:59008521-59008543 AATCACTTTTTAGAAGTGAGTGG + Intronic
1085993073 11:81875143-81875165 AATCAAGTTTAAAAAATATGAGG - Intergenic
1086331700 11:85760944-85760966 AATCAAGATTCTGCAGTATGAGG + Intronic
1086750056 11:90481161-90481183 AATCACCTTTCACAAGTATGTGG + Intergenic
1086884191 11:92184396-92184418 ATTCAGGTTTTAGGAGTATCAGG + Intergenic
1087136257 11:94723424-94723446 AATGAAGTTTTAAAATTATGTGG - Intronic
1087353790 11:97068409-97068431 AATCAAATATTTGAAGTATCAGG - Intergenic
1087450851 11:98322168-98322190 ATACAAGTTTTAAAATTATGTGG + Intergenic
1088125366 11:106417565-106417587 GAACAAGTTTGAGAAGTATCAGG + Intergenic
1092012882 12:5130274-5130296 AATCAAGTTTGAGAATGATTAGG - Intergenic
1092489480 12:8932447-8932469 AACCTAGTTTTGGAATTATGCGG - Intronic
1093856992 12:24116934-24116956 GATAAAGTTTTAGAAATATAGGG - Intergenic
1094158417 12:27362674-27362696 AATCAATTTTTAGGAATATTTGG - Intronic
1094226367 12:28050717-28050739 AATCAAGTTCTAATAGAATGAGG - Intergenic
1094662757 12:32486635-32486657 GCTCATGTTTTAGAAGTAGGGGG - Intronic
1095590911 12:43902655-43902677 ATTAATGTTTTAGAAGTAAGAGG + Intronic
1095769494 12:45937010-45937032 CATAAAGTTCTAGAAGTCTGAGG - Intronic
1096192504 12:49629472-49629494 AATTAATTTTTAGAAGTAGAAGG + Intronic
1099481155 12:83168249-83168271 TATCAAGATTTAGAAGGTTGTGG - Intergenic
1099624564 12:85053414-85053436 AATAAAGTCTTAGAAGCATCTGG + Intronic
1101569656 12:105941449-105941471 AAACAAGATTTGCAAGTATGGGG + Intergenic
1103002763 12:117397871-117397893 TATCAAGTTTTAGAAATCTGTGG - Intronic
1107522344 13:41195578-41195600 AATCAAGTATTAGAGATTTGAGG + Intergenic
1107929152 13:45292488-45292510 AATTATGTGTTAGAAGTTTGAGG + Intergenic
1108485806 13:50923276-50923298 AATCAAATTTGGGAAGTATTTGG - Intronic
1108878162 13:55074093-55074115 AATCTGGTTGTAGGAGTATGTGG + Intergenic
1109373939 13:61464103-61464125 AAACATGTTTTATAAATATGAGG + Intergenic
1110228651 13:73145787-73145809 AATCAGATTTTAGAAGTCTGGGG + Intergenic
1110689330 13:78413472-78413494 AGTAAAGTTTTAGTAGTCTGTGG + Intergenic
1113209137 13:107954713-107954735 AATGAATTTTGAGAAGTATGGGG - Intergenic
1113984754 13:114304704-114304726 CATCAAGTTCTAGAAATATAGGG + Intronic
1114041419 14:18682060-18682082 AATTATGTTTTATAGGTATGTGG - Intergenic
1114842674 14:26283630-26283652 ATTAAAGATTTAGCAGTATGAGG + Intergenic
1114843677 14:26295418-26295440 AATCAATTTATAATAGTATGGGG + Intergenic
1115101038 14:29700290-29700312 AAACAAGTTTTAAAACTATTGGG - Intronic
1115227190 14:31116056-31116078 GATTAAGTTTTAGAAGTAGAAGG - Intronic
1115480109 14:33852293-33852315 AAGTAAGTTTTAGAAATATTAGG + Intergenic
1118218624 14:63833726-63833748 TATTAAGTTTTAGAAATATTAGG - Intergenic
1118426006 14:65662917-65662939 ATTCAAGTTTTAGAAATACAAGG - Intronic
1119491717 14:75039822-75039844 AATCAAATTTTAGAAGAGTTAGG + Intronic
1124108341 15:26762446-26762468 AATACAGTTTAAGAAATATGGGG - Intronic
1126528249 15:49682548-49682570 AATCTAGTTTTAAAAATATTTGG - Intergenic
1126592878 15:50357359-50357381 AAACAAGTTTTAAAAATAAGAGG + Intergenic
1127738440 15:61870775-61870797 AATCAAGTGTTAAGAGGATGTGG - Intronic
1128118046 15:65124647-65124669 AATCAAGTTTAAGATTTAAGAGG - Intronic
1128436502 15:67655757-67655779 AATCAAATTTAGGAAGTTTGGGG + Intronic
1128513800 15:68329428-68329450 AGTCATGTTTGAGAACTATGGGG + Intronic
1134324039 16:13190532-13190554 AATCCAGTTTTAGAAGGCAGGGG - Intronic
1135029063 16:19023227-19023249 AATCAATTTTTAGTAGATTGAGG - Intronic
1135858320 16:26032454-26032476 TATCAAGTTTTATAAAAATGTGG - Intronic
1137416359 16:48285378-48285400 CATCAAATTTGAGAAGTATGTGG + Intronic
1137513349 16:49120539-49120561 GTTCTAGTTTTAGAAGCATGAGG - Intergenic
1141111417 16:81273838-81273860 AGCCAAGTTTTAAAAGTATTAGG + Intronic
1142557860 17:791745-791767 GATGAAGTTTCACAAGTATGAGG + Exonic
1143181352 17:4986330-4986352 AATCCAGGATGAGAAGTATGAGG + Intronic
1145193110 17:20864928-20864950 AATAAAATTTTAGAAATATAGGG - Exonic
1145197250 17:20905152-20905174 AAACAAGTCTAAGAATTATGAGG - Intergenic
1145227201 17:21139768-21139790 AAGCAAGTTTTAAAATTATTGGG - Intronic
1145298906 17:21616165-21616187 AATAAAATTTTAGAAATATAGGG + Intergenic
1145351374 17:22087121-22087143 AATAAAATTTTAGAAATATAGGG - Intergenic
1145403523 17:22566926-22566948 AATAAAATTTTAGAAGCATAGGG - Intergenic
1145723395 17:27092911-27092933 AATAAAATTTTAGAAATATAGGG + Intergenic
1149379618 17:56080596-56080618 CATCAAGTCTTAGGAGTATAGGG - Intergenic
1149798046 17:59539708-59539730 AAACAAGTTTTAAAAGTAGATGG + Intergenic
1152222522 17:79076572-79076594 AATCAATTTTTAAAAGAAAGTGG + Intronic
1153516847 18:5911728-5911750 ATTCTTGTTTTAGAATTATGGGG - Intergenic
1154136123 18:11779854-11779876 AATTAAATTTTTGTAGTATGAGG - Intronic
1155558577 18:27049998-27050020 AATCAAGTTTTAGAAGTATGGGG + Intronic
1155984976 18:32220328-32220350 TATCCACTTTTAGAAGAATGAGG - Exonic
1156874557 18:41993024-41993046 ACTAAAGTTTTAGAGGTATGAGG - Intronic
1157895978 18:51467705-51467727 GATCAAGTTTTAAAAGTAACTGG - Intergenic
1158456728 18:57614843-57614865 AATAATGTTTTAGAGTTATGAGG - Intronic
1158561678 18:58519435-58519457 AATTAAATTTTAGAAATGTGAGG - Intronic
1159691110 18:71488374-71488396 AAAAAAGTGCTAGAAGTATGTGG - Intergenic
1160333927 18:78019863-78019885 AATCACGTGTCAGAAGTATCTGG - Intergenic
1161653655 19:5499808-5499830 AATCAAGGTTCAGCAGTACGCGG + Intergenic
1164505476 19:28857252-28857274 AACCAAGTTTAAGAATTATTTGG + Intergenic
1166618723 19:44275654-44275676 AATGATGTCTGAGAAGTATGGGG - Intronic
927357743 2:22192649-22192671 ATTCAAGATTAAGAAGGATGTGG - Intergenic
928026863 2:27747189-27747211 AATCTAGTTTTAAAAGTGGGTGG - Intergenic
928801018 2:35092138-35092160 AATCAATTTTTGGAAGGAAGTGG - Intergenic
929800544 2:45096812-45096834 CATCAAGTTTAAGAAATATTCGG - Intergenic
930396776 2:50831655-50831677 AAACAAGTTTTAGAAATTTAAGG - Intronic
930462927 2:51706979-51707001 AATTAAGATTTAGAAGAATAGGG - Intergenic
930579557 2:53194237-53194259 AACCAATTATTAAAAGTATGAGG + Intergenic
933047910 2:77561597-77561619 AAAAAAATTTTAGAAGTTTGTGG - Intronic
934332879 2:92088836-92088858 AATCATGATTTTGTAGTATGTGG + Intergenic
934332978 2:92090547-92090569 AATCATGATTTTGTAGTATGTGG + Intergenic
935316024 2:101834600-101834622 AGTCAAGTTTTAGATGTAGAAGG + Intronic
935797152 2:106654312-106654334 AATCAAGTTTTAAAACTCTAAGG + Intergenic
937760615 2:125598120-125598142 AATGGAGTTTTAGAATAATGAGG - Intergenic
937962908 2:127475768-127475790 CTTCAATTTTTTGAAGTATGAGG - Intronic
939060276 2:137413688-137413710 AGTGAAGTTGAAGAAGTATGTGG + Intronic
939631425 2:144530391-144530413 AATTAAGCTTTAAAAGAATGGGG - Intergenic
939643864 2:144672372-144672394 AATCCTGTTTTAGAAGTTGGGGG + Intergenic
940205224 2:151195125-151195147 AAACATATTTTAGAAGTAGGAGG - Intergenic
940491017 2:154360909-154360931 AATCATACTTTAGAAGCATGGGG + Intronic
940810552 2:158237919-158237941 AATCAAGTTTTCCAAGGAGGAGG + Intronic
941152931 2:161937970-161937992 AATCAAGCTTTTAAAGTATCAGG + Intronic
941723226 2:168834542-168834564 AATAAAGTTTAAAATGTATGTGG - Intronic
942159566 2:173168742-173168764 AATCAAGAATTATAAATATGAGG - Intronic
942325997 2:174777702-174777724 AAGCAGGTTTTAGAAATAGGAGG + Intergenic
942465081 2:176199196-176199218 ACTCAAGTTTCAGATGTAAGAGG - Intergenic
942871204 2:180736435-180736457 AATCAATATTCAGAAGAATGAGG - Intergenic
943530833 2:189078094-189078116 AACCACCTTTTAGGAGTATGAGG + Intronic
943715522 2:191148149-191148171 AATCAAGTTTTTGGAGCAGGTGG - Exonic
944140514 2:196451129-196451151 AAGCAAGCTTAAGAAATATGGGG + Intronic
944270169 2:197774093-197774115 ATCCAACTTTAAGAAGTATGGGG - Exonic
945692902 2:213064024-213064046 AAGCAAATTTTAAAATTATGAGG - Intronic
945778947 2:214143031-214143053 AAACGATTTTTAAAAGTATGAGG - Intronic
948180325 2:235974248-235974270 AAGCAAGTCTTTGAGGTATGTGG + Intronic
1169576996 20:6974424-6974446 AATCAAGTTAAATATGTATGAGG - Intergenic
1169972610 20:11285187-11285209 AATCAATATTTAGAACTCTGGGG + Intergenic
1170509958 20:17066367-17066389 AATCAAGATTTAGAAGGTAGAGG + Intergenic
1170652932 20:18259308-18259330 AATCAAGATTTATAAGTATAGGG + Intergenic
1171561621 20:26132080-26132102 AATAAAATTTTAGAAATATAGGG - Intergenic
1173268889 20:41513441-41513463 ACTACATTTTTAGAAGTATGTGG - Intronic
1174538614 20:51272162-51272184 AGTCAAGTCTTAGAAGTCTAAGG - Intergenic
1176649633 21:9533222-9533244 AATAAAATTTTAGAAATATAGGG + Intergenic
1176675960 21:9777636-9777658 AATCAAGTTTTAGAAATAAATGG - Intergenic
1177247591 21:18549731-18549753 ACTCAAGTTTTACATGTGTGTGG + Intergenic
1178747767 21:35269746-35269768 ATTCACATTTTAGAAATATGAGG + Intronic
1182936715 22:34229685-34229707 AATCACGTTTTATAAATATCTGG + Intergenic
1202727299 2_KI270716v1_random:15444-15466 AATCATGATTTTGTAGTATGTGG + Intergenic
1202727399 2_KI270716v1_random:17155-17177 AATCATGATTTTGTAGTATGTGG + Intergenic
951956857 3:28266265-28266287 AATTAAATTTTAGAAGTATAAGG - Intronic
952618190 3:35301082-35301104 AAATAAGTTTAAGAAGGATGTGG - Intergenic
955233080 3:57116145-57116167 GATGGAGTTTTACAAGTATGGGG - Intronic
958564588 3:95793130-95793152 AATCAAGTTATAGAAGTTACCGG - Intergenic
958564672 3:95794567-95794589 AATCAAGTTATAGAAGTTACCGG + Intergenic
958580269 3:96009208-96009230 AATAGAGACTTAGAAGTATGAGG + Intergenic
959508909 3:107187662-107187684 AATCAAGATTTGGCAGTTTGTGG - Intergenic
959966540 3:112361934-112361956 AATTAAGTTTTAGAGCTATGTGG - Exonic
960293743 3:115917471-115917493 AAGTAAGTTTTAAAAGTATCCGG - Intronic
964315332 3:155437829-155437851 AGACAAGTTTTAGAAATATATGG - Intronic
964926684 3:161967315-161967337 AATCAAATTTGAGAAGAAAGGGG + Intergenic
965045119 3:163567897-163567919 TATCAAGTTTTAAAATTATGAGG - Intergenic
965137650 3:164793176-164793198 AAGCAAGGTTTAGAAGTACCTGG - Intergenic
965284023 3:166793758-166793780 AATCCCGCTTTATAAGTATGAGG - Intergenic
965392950 3:168127875-168127897 AGTCATGTTTGAGAGGTATGGGG + Intergenic
966873861 3:184310083-184310105 AGTCAAGTTAGAAAAGTATGAGG - Intronic
968243041 3:197110029-197110051 AATCAAGTTCTAGAAGTTTTTGG + Intronic
970182368 4:13412770-13412792 AATTAAGTTTTAAAAATATATGG - Intronic
971912560 4:32813148-32813170 ATTAAAGTTTTACAAGTGTGTGG + Intergenic
973855925 4:55009734-55009756 AATCAAGGATTGGAAGGATGAGG - Intergenic
974660221 4:64878592-64878614 AGTGAAGGTTTAGAAGTATTAGG + Intergenic
974728683 4:65832723-65832745 TTTCAAGTTTTAGCAATATGAGG + Intergenic
974915199 4:68171089-68171111 AAGCTACTTTTAGAGGTATGGGG + Intergenic
975263888 4:72338776-72338798 AATTATCTTTTAGAAGTAGGTGG + Intronic
976017717 4:80578712-80578734 AATCAAGGTTCAGAAAAATGTGG + Intronic
976979913 4:91215003-91215025 AATAAAGTTTTAGAAGTTAAGGG + Intronic
978230815 4:106396281-106396303 CATCAAATTTGAGAAGTCTGGGG + Intergenic
978706731 4:111722095-111722117 AATCAAGATTTACAAAGATGAGG - Intergenic
979166888 4:117545180-117545202 TAGCAAGTGTTAGAAGGATGTGG + Intergenic
979185272 4:117782479-117782501 AATCAAATTTATGCAGTATGAGG - Intergenic
979410083 4:120366883-120366905 AATCTGGATTTAGAAGCATGGGG + Intergenic
979548884 4:121967939-121967961 ATTCCAGTTTTAGAAGAATTAGG + Intergenic
982666519 4:158271000-158271022 AAACAACTTTTAAAAGTGTGAGG - Intergenic
983700391 4:170585758-170585780 AAACAAGTTTTAAGAGAATGTGG - Intergenic
983868142 4:172792456-172792478 AATGAAGTCCTGGAAGTATGGGG + Intronic
984151660 4:176141046-176141068 TATGAAGTTTTAGAAGTGTATGG - Intronic
984240314 4:177210856-177210878 GATGAAGTTTTAGATGGATGAGG - Intergenic
985220912 4:187704228-187704250 ACTCAAGTTTTATAAGTAAATGG - Intergenic
985399580 4:189581106-189581128 AATCAAGTTTTATAAATAAATGG + Intergenic
986835755 5:11635208-11635230 AAGCAAGATTTAGAAGAATATGG + Intronic
987238368 5:15967385-15967407 AATCATGTTTTAGATTTATAAGG + Intergenic
988460514 5:31432488-31432510 AATAAAGATTTAGAAGTGTAAGG - Intronic
989111333 5:37909126-37909148 AATCAATTTTTAGCATTTTGGGG - Intergenic
990225267 5:53644345-53644367 AAGCATGTTATAGAATTATGGGG - Intronic
990873709 5:60461518-60461540 ATTCAAGATTCAGAAGTATCTGG + Intronic
992723943 5:79588097-79588119 AAGCAAGTTGTAGAAGAATATGG + Intergenic
993538202 5:89114500-89114522 AACCAATTTGTAGAAATATGTGG + Intergenic
993630666 5:90282291-90282313 AATCAACATTTAGAATTCTGGGG - Intergenic
993925928 5:93866319-93866341 AATCAATTTTAAGAACTAAGGGG - Intronic
994404328 5:99324894-99324916 AAAAAACTTTTAGAAGTCTGGGG + Intergenic
994570860 5:101512129-101512151 TTTCAAGTTTCAGAAGGATGAGG + Intergenic
994810593 5:104513652-104513674 AATCAAGTTTTAGAACTATTGGG - Intergenic
995369504 5:111403120-111403142 AATCAGTTTTTAGAAATTTGTGG - Intronic
997146152 5:131435559-131435581 ATTCAAGTTTATGAAGTCTGGGG + Intronic
998809057 5:145947916-145947938 AATAAAGTTTAAGTGGTATGTGG - Intronic
999528940 5:152440601-152440623 AGTAAAGTTTTATAAGTATTAGG - Intergenic
1001004357 5:168037074-168037096 AATCAAGTTTTAAATGTTTCAGG + Intronic
1003441333 6:6145456-6145478 AAGCATGTTTTTGAAATATGTGG + Exonic
1003604305 6:7545125-7545147 CATTAAGTTTCAGAAATATGTGG + Intronic
1003695397 6:8401489-8401511 AATTATGTTTTAGAAATGTGGGG + Intergenic
1004428504 6:15522920-15522942 AATCCAGTTTTGGCTGTATGCGG - Exonic
1006376042 6:33672159-33672181 AAGCAAGTTTGAGGAGAATGAGG + Exonic
1008088366 6:47267867-47267889 AATCAAGATTCAGAAAGATGGGG - Intronic
1008282744 6:49615634-49615656 AAACAAGTCTGAGTAGTATGCGG + Exonic
1010240309 6:73609240-73609262 AAAATGGTTTTAGAAGTATGTGG + Intronic
1010545160 6:77145234-77145256 AATCAGATTTTAGAAATATCAGG + Intergenic
1012723114 6:102773182-102773204 ATTCAAGATTTAAAAGTATTTGG - Intergenic
1013825575 6:114206877-114206899 CATCAAGTTTGAGAAGGTTGTGG + Intronic
1015852716 6:137590429-137590451 AAACACGTTTGAGAAATATGTGG + Intergenic
1016099359 6:140078652-140078674 AATAATTTTTTAAAAGTATGAGG + Intergenic
1016592125 6:145757453-145757475 AATAAAATTTAAAAAGTATGAGG - Intergenic
1020926718 7:14336883-14336905 AATCAATTTGTATAAGTATCGGG + Intronic
1021015974 7:15534050-15534072 AAGCTATTTTAAGAAGTATGAGG + Intronic
1021062860 7:16134739-16134761 AAGCAAGTCTTAGAAATATCAGG - Intronic
1021919274 7:25467637-25467659 CATAAAGTTTTAGAAGGATTTGG - Intergenic
1022710861 7:32848584-32848606 AATCAGGGTTTACAAATATGTGG - Intergenic
1023163242 7:37318532-37318554 AATCAAGTTTTAAAAGACAGAGG + Intronic
1024769315 7:52699636-52699658 AATAAAATTTTAAAATTATGCGG + Intergenic
1025920302 7:65905821-65905843 AATCAAGTTTTTGAAAAATCTGG - Intronic
1027886340 7:83910810-83910832 TAACAGATTTTAGAAGTATGAGG + Intergenic
1028765791 7:94558192-94558214 AATAATGTTTTACAAGGATGTGG + Intergenic
1030545629 7:110891584-110891606 AATCCAGTATTTGAAGTTTGTGG - Intronic
1031093237 7:117387988-117388010 ATCCAGATTTTAGAAGTATGAGG + Intronic
1032757927 7:134909225-134909247 TATCAATTTTTAAAAGTAAGAGG + Intronic
1033396848 7:140982883-140982905 ATTCAAGTTTTAGAGCTAGGTGG - Intergenic
1034453424 7:151150161-151150183 AATTAAGTTTTAGAATTGTGTGG - Intronic
1037209172 8:16364078-16364100 AATCAATTTTTAAAAGTTTGGGG - Intronic
1041669828 8:60480862-60480884 AATGAACTTGTAGAAGTAGGAGG + Intergenic
1042392528 8:68252288-68252310 GAGCAAATGTTAGAAGTATGTGG - Intergenic
1042940932 8:74107238-74107260 AATTAAGTTTCAGGAGTCTGGGG + Intergenic
1043071886 8:75647078-75647100 TATCATATTTTAGAAGTCTGAGG + Intergenic
1044457788 8:92408609-92408631 AGTTAAGTTTTAGGAGTATTTGG + Intergenic
1044799689 8:95941588-95941610 AATCATATTTTGGAAGTATCTGG + Intergenic
1044819593 8:96146523-96146545 AATGAAGTTTCAGAAGTATTGGG + Intronic
1045013130 8:97975918-97975940 AATGAACTATTAGAAGGATGTGG + Intronic
1045394224 8:101744538-101744560 TATCAAGTTTTAAAAGTCTTAGG + Intronic
1046390937 8:113571751-113571773 AATGAAGTTGAAGAACTATGTGG + Intergenic
1047043773 8:121028396-121028418 AATCAAGTTTTGCAAGTCTTTGG - Intergenic
1047786777 8:128161225-128161247 AATCTAGTTTTAGAAGTATAAGG + Intergenic
1047879346 8:129176510-129176532 AATCAATTTTTTGAAGGATAAGG + Intergenic
1047879353 8:129176544-129176566 AATCAATTTTTGGAAGGATGGGG + Intergenic
1048897204 8:139002517-139002539 GATCAAGTTTTAGGAGACTGGGG + Intergenic
1051264183 9:15295372-15295394 AGTCAAGTTTGAGAAGTTTGTGG + Intronic
1052190767 9:25658812-25658834 AGTCAAGTTTTATAAGCATAGGG - Intergenic
1053673958 9:40402554-40402576 AATTAAGTTTTATAATTATATGG + Intergenic
1054959160 9:70948021-70948043 AATCAAGTTAAGGAATTATGTGG - Intronic
1055268199 9:74523737-74523759 AATCAAGTTTAAAAAGTGTTTGG - Intronic
1055703368 9:78970929-78970951 AATTAAGTTTTAAAAATATTTGG + Intergenic
1056123078 9:83508778-83508800 AATCAAGTTTTACAGGCATACGG + Intronic
1056170192 9:83978549-83978571 AATCAAGTTTTAGAAACAGCTGG - Intronic
1203627374 Un_KI270750v1:36770-36792 AATAAAATTTTAGAAATATAGGG + Intergenic
1186900481 X:14050054-14050076 AATCAATTTTCTGAAGTAAGTGG - Intergenic
1187126008 X:16455094-16455116 ATTCAAGTTTTAGAAATATCTGG - Intergenic
1187394077 X:18905166-18905188 AAAAAAGTGTTAGAAGTGTGGGG - Intronic
1188692223 X:33144131-33144153 AAGCAAATTTTAGAAATAAGAGG + Intronic
1189196476 X:39157979-39158001 AATCAAGTGTTAGAAATCTGGGG - Intergenic
1193505523 X:82337619-82337641 AAATATGTTTTAGAAATATGTGG - Intergenic
1193861613 X:86674105-86674127 AATGAAGTTTTAGCATTCTGGGG - Intronic
1194588224 X:95764179-95764201 ACTCAATTTTTAGAAGAAAGAGG - Intergenic
1196885975 X:120245904-120245926 AAACAAATTTTAGAAGTAGTAGG - Intergenic
1197858763 X:130947852-130947874 AATCAAGATTTTGCAGTCTGAGG + Intergenic
1198815715 X:140587947-140587969 AATCAAGTTTGAGAGGTGTTTGG - Intergenic
1199025121 X:142927748-142927770 AATAAAGTTTAAGCAGTCTGAGG + Intergenic
1200412863 Y:2878419-2878441 AATCAAATTTTAGAAGAAGCAGG - Intronic
1201477730 Y:14401685-14401707 AATCCAGTTTGAGAAGTTTAAGG + Intergenic