ID: 1155558578

View in Genome Browser
Species Human (GRCh38)
Location 18:27049999-27050021
Sequence ATCAAGTTTTAGAAGTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155558571_1155558578 8 Left 1155558571 18:27049968-27049990 CCTCAACAAAGTGCAGGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1155558578 18:27049999-27050021 ATCAAGTTTTAGAAGTATGGGGG 0: 1
1: 0
2: 1
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155558578 Original CRISPR ATCAAGTTTTAGAAGTATGG GGG Intronic
901798859 1:11695739-11695761 ATGAAGTTTGAGGAATATGGAGG + Intronic
908209275 1:61883236-61883258 AATAAGCTTGAGAAGTATGGTGG - Intronic
909772434 1:79440730-79440752 ATCAAGTATAAGAAGTATCAAGG + Intergenic
911218889 1:95226029-95226051 CTCAATTTTTAGAAGTATTGGGG - Intronic
911381511 1:97120785-97120807 AGCAAGTTGAAGAAATATGGAGG + Intronic
914426392 1:147581025-147581047 ATCTGGTTTTAGAAGTATTTTGG + Intronic
916698528 1:167265963-167265985 AACAAGTTGTAGAAGTATACAGG - Intronic
918952312 1:191154240-191154262 AGAAAGTTATAGAAATATGGAGG + Intergenic
1062765982 10:65285-65307 ATTAAGTGTTAGAAGTTTAGGGG - Intergenic
1064007832 10:11712529-11712551 ATCACGTCTTGGAAGCATGGTGG + Intergenic
1069089587 10:64183452-64183474 GTCCAGTTTAAGAAGAATGGTGG + Intergenic
1069542143 10:69303162-69303184 CTCAAATTTTAGAAATATAGAGG + Intronic
1071679492 10:87690418-87690440 ATCTACTTTTAGAAGTGAGGAGG + Intronic
1072043841 10:91635023-91635045 ATCAATGGTTAGAATTATGGAGG + Intergenic
1077891848 11:6424172-6424194 ATTCAGTTTTTGCAGTATGGAGG + Intergenic
1078218180 11:9329375-9329397 CTCAAGTTTCAAAAGAATGGAGG + Intergenic
1082555386 11:54558007-54558029 ATTAACTTTTCGAAGTTTGGAGG + Intergenic
1085977079 11:81669811-81669833 TTCAAATTTTGGAATTATGGGGG - Intergenic
1086303088 11:85450894-85450916 TTCAATGTTTAGAAATATGGAGG - Intronic
1087681845 11:101227304-101227326 AGAAAGTTTTAGAAATATGAAGG + Intergenic
1088125367 11:106417566-106417588 AACAAGTTTGAGAAGTATCAGGG + Intergenic
1088643175 11:111893665-111893687 GTTTAGTGTTAGAAGTATGGAGG + Intergenic
1089851320 11:121499141-121499163 GTCAATTTTTAGAAATTTGGTGG + Intronic
1092646331 12:10577537-10577559 ATCAAGTTATAGAGTCATGGAGG + Intergenic
1094280249 12:28729262-28729284 AGCATTTCTTAGAAGTATGGTGG + Intergenic
1095926457 12:47584278-47584300 ATCAAGTTTGAGATGTCTGTTGG + Intergenic
1097609438 12:61800578-61800600 ATGATGTTTCAAAAGTATGGAGG + Intronic
1097674830 12:62588879-62588901 AACAAGGTTTAAAAGTAGGGTGG - Intronic
1098191210 12:67950880-67950902 ATCAAGTTTCAGAAGAATTCAGG - Intergenic
1099481154 12:83168248-83168270 ATCAAGATTTAGAAGGTTGTGGG - Intergenic
1101569657 12:105941450-105941472 AACAAGATTTGCAAGTATGGGGG + Intergenic
1106053991 13:26221636-26221658 GTCAAGGTTTAGAAGTAAGCCGG - Intronic
1106563419 13:30865582-30865604 ACCCAGTTTTATAAGCATGGAGG + Intergenic
1107154011 13:37145555-37145577 TGAAAGTTTTAGAAGTATTGTGG + Intergenic
1109249973 13:60007621-60007643 ATTAAGTTTTAGAAGTACGGAGG + Intronic
1109667742 13:65560481-65560503 ATTATATTTTAGAATTATGGTGG - Intergenic
1110575572 13:77051268-77051290 ATCAATTTTTAGAGTTATGTAGG - Intronic
1112125346 13:96460503-96460525 ATCAGGTTTTGGAAGTATCATGG + Intronic
1113399770 13:109980262-109980284 ATCAATTTCTAAAAGTATTGTGG - Intergenic
1114003922 14:18290751-18290773 AACAATTTTTAAAAGCATGGTGG - Intergenic
1114843678 14:26295419-26295441 ATCAATTTATAATAGTATGGGGG + Intergenic
1115062781 14:29213800-29213822 ATCAAGTGTTTGAAGTTTGTTGG - Intergenic
1115101037 14:29700289-29700311 AACAAGTTTTAAAACTATTGGGG - Intronic
1116178192 14:41500504-41500526 AACAAGGTTTTGAATTATGGTGG - Intergenic
1116233241 14:42245318-42245340 AGCATGTTTTAGAAGTTTTGTGG - Intergenic
1116926448 14:50642974-50642996 TTCCACTTTTACAAGTATGGAGG - Intronic
1117790207 14:59332353-59332375 TGGAATTTTTAGAAGTATGGAGG + Intronic
1118228959 14:63929917-63929939 ATGAAGTTTTAGAGGTAGGCAGG + Intronic
1118741788 14:68744983-68745005 CGGAAGTTTTAGAAGTGTGGTGG - Intergenic
1118831938 14:69441482-69441504 ATTCAGTTCTAGAAATATGGAGG - Intronic
1125308202 15:38346617-38346639 AACAAGTTTTAGAACTATCAAGG - Intronic
1134324038 16:13190531-13190553 ATCCAGTTTTAGAAGGCAGGGGG - Intronic
1138849363 16:60607611-60607633 AAGAAGTTTTAGAAGTTTAGGGG + Intergenic
1143197994 17:5091177-5091199 ATCCAGATTTAGGATTATGGTGG - Intronic
1145232191 17:21181408-21181430 ATCTAGTTTTCAAAGTCTGGAGG + Intronic
1148036825 17:44669884-44669906 ATCAAGTTTTAGAGCTTTGAAGG + Intronic
1148726534 17:49795424-49795446 ATCACCTTGAAGAAGTATGGTGG + Intronic
1152958855 18:64861-64883 ATTAAGTATTAGAAGTTTAGGGG - Intronic
1154954176 18:21239535-21239557 ATCATCTTTTATAATTATGGAGG + Intergenic
1155424625 18:25694092-25694114 ATCTAATTTTGGCAGTATGGTGG - Intergenic
1155558578 18:27049999-27050021 ATCAAGTTTTAGAAGTATGGGGG + Intronic
1156080081 18:33322369-33322391 ATCAAGTTTACTAAGCATGGAGG - Intronic
1158760336 18:60377993-60378015 AACAAGTTCAAGAAATATGGGGG - Intergenic
1159026609 18:63188355-63188377 ATCAACTTTTACAATTTTGGAGG + Intronic
1159178917 18:64875582-64875604 TTCAAGCTTTAGAAATCTGGAGG - Intergenic
1159420772 18:68216639-68216661 ACCAAGTTTTAGGAGTTTGGTGG - Intergenic
1160360690 18:78274251-78274273 ATTAATTTTTAAAACTATGGAGG - Intergenic
1163295311 19:16407952-16407974 ATTAAGTCTAAGAAGTTTGGGGG + Intronic
927616184 2:24598921-24598943 ATCTAGTTTTACATGTATGATGG + Intronic
927830236 2:26344120-26344142 ACTAAGTTTTACAAGTATGAAGG + Intronic
930283370 2:49397976-49397998 ATTAGGTTATACAAGTATGGGGG + Intergenic
930456822 2:51616095-51616117 AAGAAGTTTTAAAAGTTTGGAGG - Intergenic
932568947 2:72927227-72927249 ATGAAGTTTGAGATGAATGGTGG - Intronic
933091785 2:78128850-78128872 AGCAAAATTTAGAAGTATGGAGG - Intergenic
933170762 2:79122156-79122178 ATCAGGTTTGAGAAGTAAGAAGG + Intronic
933324120 2:80814571-80814593 ATCCAGTTTTAGAATAATAGTGG - Intergenic
936268991 2:111033922-111033944 ATCAAGTTTGAAAAGGAAGGGGG + Intronic
936786616 2:116100709-116100731 ATATATTTTTAGTAGTATGGTGG - Intergenic
939527327 2:143313234-143313256 ACCGAGTTTTTGAAGTATGACGG + Intronic
939643865 2:144672373-144672395 ATCCTGTTTTAGAAGTTGGGGGG + Intergenic
939651842 2:144772787-144772809 ATCAAATTCTAGAAGGATGAAGG - Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
941262687 2:163317482-163317504 AACCAGATTTAGAAGTTTGGAGG + Intergenic
941346079 2:164371265-164371287 GTCAAGTCTTAGATGGATGGTGG + Intergenic
942220487 2:173764066-173764088 ATGAAGTTTTAGGAGCATGTTGG + Intergenic
942551784 2:177127396-177127418 ATCATGTTTTAGAGAGATGGAGG - Intergenic
943388867 2:187236316-187236338 ATCAAGTCTCAAAAATATGGAGG - Intergenic
944170417 2:196770365-196770387 ATCTAGTTTGAAAAGAATGGAGG + Intronic
945023022 2:205593098-205593120 ATCCAGTTTTAGAACTACAGAGG + Intronic
945664599 2:212725070-212725092 CCCAAGTTTTAGAAGAATGCTGG + Intergenic
1170410775 20:16089072-16089094 ATAAAATGTGAGAAGTATGGCGG - Intergenic
1171114006 20:22508839-22508861 ATCATGTTGTAGGAGTTTGGAGG - Intergenic
1175341784 20:58236169-58236191 ATCAAGTTTCTGAAGTTCGGTGG - Intergenic
1177058544 21:16340549-16340571 ATCAAGTTTAAAAATTATAGTGG - Intergenic
1178605757 21:34035312-34035334 AACAAGTTTGAGAAATCTGGGGG - Intergenic
1180428436 22:15221554-15221576 AACAATTTTTAAAAGCATGGTGG - Intergenic
951956856 3:28266264-28266286 ATTAAATTTTAGAAGTATAAGGG - Intronic
952168098 3:30773763-30773785 ATTAAGTTATAGAAATATGGAGG - Intronic
955233079 3:57116144-57116166 ATGGAGTTTTACAAGTATGGGGG - Intronic
956177884 3:66490539-66490561 ATCTGGTTTTAGCAGTGTGGTGG - Intronic
957989337 3:87610091-87610113 CCCAAGTATTAGAAGTAAGGTGG - Intergenic
958767061 3:98381593-98381615 ATAAAGTTTTACAAGTACGATGG + Intergenic
959852083 3:111099338-111099360 ATCTAGGTTTACAAGTATTGTGG + Intronic
960257429 3:115525841-115525863 ATCAAGTTTTCAAAGAATGCAGG - Intergenic
960406578 3:117268151-117268173 AACCATTTTTAGAAATATGGGGG + Intergenic
963331251 3:143918944-143918966 CTTGAGTTTCAGAAGTATGGTGG + Intergenic
965060292 3:163776002-163776024 ATCAAGTGTTAGAAGTGATGTGG - Intergenic
965249258 3:166321330-166321352 ATCAAATTTTAAAAGTACGTTGG - Intergenic
965392951 3:168127876-168127898 GTCATGTTTGAGAGGTATGGGGG + Intergenic
965941658 3:174190782-174190804 AAAAAGTTCTAGAAGTATGTAGG - Intronic
966135310 3:176691636-176691658 ACCAAATTTTACAAGTATTGTGG - Intergenic
968243042 3:197110030-197110052 ATCAAGTTCTAGAAGTTTTTGGG + Intronic
973067502 4:45815087-45815109 TTCAAATTCTAAAAGTATGGAGG + Intergenic
973599825 4:52531136-52531158 ATGGAGTTTAAGAAGTAAGGGGG - Intergenic
974189333 4:58483826-58483848 ATAAAATTTTAGGAGAATGGGGG - Intergenic
974189353 4:58484045-58484067 ATAAAATTTTAGGAGAATGGGGG + Intergenic
974728684 4:65832724-65832746 TTCAAGTTTTAGCAATATGAGGG + Intergenic
976583237 4:86764835-86764857 ATTCAGTTTTAGAATTTTGGAGG - Intronic
976886126 4:89986670-89986692 ATGAAGTTTTAGAGGAACGGAGG - Intergenic
977204496 4:94154160-94154182 ATAAATTTTTAGTAGTATAGTGG - Intergenic
978750865 4:112246070-112246092 ATGAAGTTTTAGACGTATATAGG - Intronic
979341290 4:119527006-119527028 CTCAAGTTTGGGAAGTGTGGAGG + Intronic
980062455 4:128146447-128146469 AAGAAGTTTTAAAAGTTTGGTGG + Intronic
980113497 4:128657449-128657471 GTCAAGTTCAAGAAGGATGGTGG - Intergenic
982164037 4:152598652-152598674 AGCAACCTTTAGAAGTATGTAGG - Intergenic
986815820 5:11409286-11409308 ATAAAAGTTAAGAAGTATGGAGG - Intronic
989111332 5:37909125-37909147 ATCAATTTTTAGCATTTTGGGGG - Intergenic
990696238 5:58420651-58420673 ATCAAGTGTTCAATGTATGGGGG + Intergenic
991537584 5:67689073-67689095 AGCAAGTTTTGGAAGGATGCAGG + Intergenic
996432293 5:123395313-123395335 ATAAAGTTTTAATAGAATGGAGG - Intronic
996636415 5:125694709-125694731 ACCAAGTTATAGCATTATGGTGG + Intergenic
997396345 5:133563000-133563022 ATTAAATTTTAGATGTCTGGAGG + Intronic
998456071 5:142274433-142274455 ATTAATTTTTAAAAGGATGGGGG + Intergenic
998562129 5:143181451-143181473 ATCAAGTTTAGGGAGCATGGAGG - Intronic
998808299 5:145940002-145940024 ACCAAGTTTTTGAACTATAGAGG + Intronic
1003695398 6:8401490-8401512 ATTATGTTTTAGAAATGTGGGGG + Intergenic
1005195636 6:23280675-23280697 AGCAAGTTAGAGAAGTAGGGAGG + Intergenic
1005588488 6:27300427-27300449 AGAAAGTTTAAGAAATATGGTGG - Intronic
1006878605 6:37319730-37319752 ATAGAATTTTAGAACTATGGAGG - Intronic
1007161625 6:39795891-39795913 AGCAGGTTGTATAAGTATGGTGG + Intronic
1007504119 6:42321332-42321354 ATCAAATTTGAGAAGAATAGAGG + Intronic
1007513085 6:42389660-42389682 ATCAAGTGTTTGAAGTTGGGAGG - Intronic
1007649069 6:43406279-43406301 GTCAAGTCTTAGAAGGTTGGAGG - Intergenic
1008815365 6:55558322-55558344 ATCACTTTTTAAAAGTAAGGTGG + Intronic
1010275573 6:73965087-73965109 AACCAGTTTTAGAAGCATGTAGG + Intergenic
1010788812 6:80038770-80038792 TTTAAGTTTTAGAAGAGTGGAGG - Intronic
1011631264 6:89327327-89327349 ATCCAGTTTTAGCTGTATGCTGG + Exonic
1012872194 6:104685372-104685394 ATATAGTTTTTGAAATATGGTGG + Intergenic
1014654366 6:124080961-124080983 ATCAATTTTTATTACTATGGTGG - Intronic
1016758174 6:147709886-147709908 ATTGTGCTTTAGAAGTATGGTGG - Intronic
1017532507 6:155310276-155310298 TTAAAATTTTAGAATTATGGAGG + Intronic
1017728586 6:157294298-157294320 ATCAGGTTTGTGAAGTATGCTGG + Intronic
1017985887 6:159442886-159442908 ATCAGGTCTGAGAAGGATGGAGG - Intergenic
1018559656 6:165088494-165088516 ATCAAAGGCTAGAAGTATGGAGG - Intergenic
1022411776 7:30144245-30144267 TTCAAGTTTTTGAAATGTGGTGG + Intronic
1024758977 7:52571348-52571370 ATAAAGTCTTATAAATATGGAGG - Intergenic
1032832835 7:135645848-135645870 ATCCAGCTCTAGAAGAATGGAGG + Intronic
1033982070 7:147177900-147177922 TTCAATTTTTATAAGTATGGTGG - Intronic
1034608198 7:152337835-152337857 ATCAAGTTGTATAAGTGAGGTGG - Intronic
1042071125 8:64935485-64935507 ATCAAGCTTGACAAGTATGCAGG - Intergenic
1043063522 8:75536905-75536927 AACTAGTTTTAGAAGTAGAGAGG + Intronic
1043707785 8:83375022-83375044 AGCAATTTTCAGAAGTTTGGTGG + Intergenic
1044819594 8:96146524-96146546 ATGAAGTTTCAGAAGTATTGGGG + Intronic
1047358918 8:124149860-124149882 ACCCAGCTTTAGAAGTTTGGAGG - Intergenic
1047470312 8:125164945-125164967 ATCAATTCTTAGAAGTAGTGAGG + Intronic
1052013180 9:23435063-23435085 GTCAAGTTTTAGGTGTTTGGTGG - Intergenic
1052265868 9:26572393-26572415 ATCACAATTTAGAAGTTTGGAGG - Intergenic
1052522737 9:29570269-29570291 ATCAAGGTTTAGAAATTTGAAGG - Intergenic
1054958087 9:70936139-70936161 ATCAAGTTTTAAAACCTTGGAGG - Intronic
1060616434 9:125019289-125019311 ATCAAATTTTGTAAGTATGTCGG - Intronic
1062739259 9:138158988-138159010 ATTAAGTGTTAGAAGTTTAGGGG + Intergenic
1186727346 X:12371340-12371362 ATTAAGTCTGAGAATTATGGTGG + Intronic
1187394076 X:18905165-18905187 AAAAAGTGTTAGAAGTGTGGGGG - Intronic
1191576375 X:62710766-62710788 ATCAAGGGTGGGAAGTATGGTGG - Intergenic
1193087766 X:77462637-77462659 AAAAAGTTTTGGAAATATGGTGG - Intergenic
1194295714 X:92124040-92124062 TTGAAGTATGAGAAGTATGGTGG - Intronic
1195914209 X:109920050-109920072 ATAAAGTTTCAGAAGTACTGAGG - Intergenic
1195993065 X:110702402-110702424 CTGAAGTTTTAGAAGTATAGAGG + Intronic
1196371730 X:114986633-114986655 AAGAAATTTTAAAAGTATGGTGG + Intergenic
1197187504 X:123604526-123604548 ATCAAGTTTGAAAAGTAAGGTGG + Intronic
1197875188 X:131095413-131095435 ATAAAGTTTCAGAATTATGTTGG + Intergenic
1200613218 Y:5348623-5348645 TTGAAGTATGAGAAGTATGGTGG - Intronic