ID: 1155560746

View in Genome Browser
Species Human (GRCh38)
Location 18:27073548-27073570
Sequence CAGTGTGACCAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155560746 Original CRISPR CAGTGTGACCAGAGGGAAGA TGG Intronic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902443584 1:16447399-16447421 CAGTGAGCCCCGAGGAAAGAAGG - Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG + Intergenic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137759688 16:50930320-50930342 CACTGTGACCAGAGGCTTGAAGG + Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG + Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158839194 18:61365308-61365330 CAGTGGGACCCGACAGAAGATGG - Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944875756 2:203962887-203962909 GAGTGTGACTAGACAGAAGATGG + Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947374682 2:229483694-229483716 CAGTGTGACCACAGGGTCCAGGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170196532 20:13694643-13694665 CAGTGTGACTAGAGGGACTTGGG - Intergenic
1170555519 20:17511978-17512000 CATTGTGACGAGTGGGATGAGGG - Exonic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018414375 6:163588717-163588739 CAGTGTGACCGTAGAGAATAAGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1050552984 9:6763630-6763652 CAGTGTTACCATTGTGAAGAGGG + Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic