ID: 1155561262

View in Genome Browser
Species Human (GRCh38)
Location 18:27079900-27079922
Sequence GTGGACTCCATGTCATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 17, 3: 110, 4: 435}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155561262_1155561267 9 Left 1155561262 18:27079900-27079922 CCTTGTGATGACATGGAGTCCAC 0: 1
1: 0
2: 17
3: 110
4: 435
Right 1155561267 18:27079932-27079954 TCAAAATAATCTCCCCATCTGGG 0: 1
1: 1
2: 3
3: 30
4: 295
1155561262_1155561266 8 Left 1155561262 18:27079900-27079922 CCTTGTGATGACATGGAGTCCAC 0: 1
1: 0
2: 17
3: 110
4: 435
Right 1155561266 18:27079931-27079953 TTCAAAATAATCTCCCCATCTGG 0: 1
1: 0
2: 3
3: 11
4: 161
1155561262_1155561268 10 Left 1155561262 18:27079900-27079922 CCTTGTGATGACATGGAGTCCAC 0: 1
1: 0
2: 17
3: 110
4: 435
Right 1155561268 18:27079933-27079955 CAAAATAATCTCCCCATCTGGGG 0: 1
1: 1
2: 6
3: 44
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155561262 Original CRISPR GTGGACTCCATGTCATCACA AGG (reversed) Intronic
900510564 1:3058255-3058277 GTGGCCTTAATGTCATCACGAGG - Intergenic
900726920 1:4222604-4222626 GTGGGCTCAATGTCATCACAGGG + Intergenic
900853968 1:5165629-5165651 TTGGACTCTGTGTCATCACTCGG + Intergenic
901152183 1:7111167-7111189 CTGGGCTCAATGTAATCACAAGG - Intronic
901516669 1:9752184-9752206 CTGGAGTCCATGGCATCACCTGG + Intronic
901826014 1:11861822-11861844 GAAGGCTCAATGTCATCACAAGG + Intergenic
902135640 1:14302602-14302624 TTGGACTCCATGAAATTACATGG + Intergenic
902255858 1:15188211-15188233 GTGGCCGTCTTGTCATCACAAGG - Intronic
902275804 1:15338465-15338487 GTGGACCCAATGTCATCACATGG - Intronic
903316966 1:22515646-22515668 GTGGGCTCAATGTAATCGCAAGG - Intronic
903565545 1:24262638-24262660 GTGGACCCAATGTAATCACCAGG - Intergenic
903655189 1:24944581-24944603 GTGGGCCCCATATGATCACAAGG + Intronic
903688765 1:25154049-25154071 GTGGGCTCCATCTAATCACATGG - Intergenic
904417257 1:30370877-30370899 GTGGGCCCCATGTAATCACGAGG - Intergenic
905265217 1:36748684-36748706 GTGGGCTCAATGTAATCACAAGG - Intergenic
905336106 1:37245605-37245627 GTGGGCCCAAAGTCATCACAAGG + Intergenic
905392239 1:37644188-37644210 TTGGTCTCCATGTTAACACATGG + Intergenic
905470806 1:38190333-38190355 GTGGTCCCAATGTAATCACATGG - Intergenic
905956042 1:41996975-41996997 GTGGGCTCAATGTAGTCACAAGG - Intronic
906933549 1:50192136-50192158 GTGGGCTCCTTCTCAGCACATGG - Intronic
907548642 1:55285404-55285426 GTGGACCCTATGTAATCACAAGG + Intergenic
908779015 1:67671467-67671489 GTGGATTCAGTGTCTTCACATGG - Intergenic
909679572 1:78276948-78276970 GTGGGCCCAATGTAATCACAAGG + Intergenic
909774421 1:79465943-79465965 GTAGGCTCAATGTAATCACAAGG - Intergenic
910205152 1:84742422-84742444 GTGGGCCCGATGTCATCATAAGG + Intergenic
910207810 1:84765289-84765311 GTGGGCTCAATGTAATCACAGGG - Intergenic
911026049 1:93436082-93436104 GGGGGCCCAATGTCATCACAAGG - Intergenic
911722105 1:101202694-101202716 GTGGGCCCAATGTAATCACAAGG - Intergenic
914415703 1:147479517-147479539 GTAGACCCAATGTAATCACAAGG - Intergenic
915505246 1:156351390-156351412 GTGGGCTCAATATAATCACAAGG - Intronic
915567110 1:156721300-156721322 GCAGACTCCATGTCTACACAAGG - Intergenic
916295974 1:163220771-163220793 GTGGGCCCAATGTCATCACAAGG + Intronic
917137338 1:171800343-171800365 GTGGACTCCACGTAATCTCAAGG + Intronic
917794624 1:178523989-178524011 GTGGGCTCAATGTAATCACAAGG - Intronic
918810468 1:189112000-189112022 GTGGATACGATGTAATCACAGGG - Intergenic
919086981 1:192932136-192932158 GTGGGCTCAGTGTCATCAAAGGG - Intergenic
919160289 1:193821191-193821213 GTGAACCCAATGTAATCACAAGG + Intergenic
921309779 1:213831290-213831312 GTTGACTCAATCTAATCACAAGG + Intergenic
922613736 1:226948360-226948382 GTGGGCCCAATGTAATCACAAGG - Intronic
923052450 1:230398351-230398373 GCGGTCTCCATGTCTTCGCATGG + Intronic
923625888 1:235613471-235613493 GTGGACCCTATGCAATCACAAGG + Intronic
924587821 1:245375402-245375424 GTGGACTCAATGTAATTACAAGG + Intronic
924718322 1:246599562-246599584 GTGGACCCAGTGTAATCACAAGG - Intronic
1062869691 10:889343-889365 GAGGACACCATCCCATCACAGGG + Intronic
1063361758 10:5465152-5465174 GTGGACACTTTGTCCTCACATGG - Intergenic
1063810206 10:9696194-9696216 GTGGACTAAATGTCATCAAAAGG + Intergenic
1064210657 10:13358172-13358194 GTGAGCTCAATGTCATCACAAGG + Intergenic
1064504433 10:16013618-16013640 GTGCAGTCCATGTGATCCCAAGG - Intergenic
1064561386 10:16598209-16598231 GTGGGCTCAGTGTCATCAAAAGG + Intronic
1065164136 10:22957212-22957234 GAGGCCTCACTGTCATCACACGG - Intronic
1065193845 10:23241649-23241671 GTGGGCCCAATGTAATCACAAGG + Intergenic
1066113948 10:32223062-32223084 CAGGACTCCATTCCATCACAGGG - Intergenic
1066210036 10:33227530-33227552 GTGGATTCCAAGTCATCAGGTGG + Intronic
1068554241 10:58440185-58440207 CTGGGCCCAATGTCATCACAGGG - Intergenic
1069762401 10:70820985-70821007 GTGGACTCCAGGTCATCTCCAGG - Intronic
1071737025 10:88312209-88312231 GTGGGCCCAATGTCATCACAAGG + Intronic
1071952257 10:90717271-90717293 GAGTTCTCTATGTCATCACATGG - Intergenic
1072257308 10:93632184-93632206 GTGGACCCAATGTAATTACAAGG - Intronic
1072379706 10:94855187-94855209 GTGGGTTTCATGTAATCACAAGG - Intergenic
1072392240 10:94998823-94998845 GTGGGTTTCATGTAATCACAAGG - Intergenic
1072540227 10:96392891-96392913 GTGGGCTCAATGTCAACACCAGG + Intronic
1073298489 10:102455999-102456021 GTGGACCCAATGTAATCACAAGG + Intergenic
1074425097 10:113343648-113343670 GTGGGCTGAATGTAATCACAGGG + Intergenic
1074498456 10:114000771-114000793 GTGGACCCCATGTAATCACAAGG - Intergenic
1075142207 10:119849028-119849050 CTGGGCCCCATGTAATCACACGG + Intronic
1075476628 10:122740954-122740976 GTGGGCCCAATGGCATCACAAGG - Intergenic
1075682823 10:124344418-124344440 GTGGGCTCAATGTCATCACAAGG - Intergenic
1076071343 10:127492434-127492456 GTAGACCCAATGTAATCACAAGG - Intergenic
1076207284 10:128613260-128613282 ATGGGCCCAATGTCATCACAAGG - Intergenic
1076322723 10:129595413-129595435 ATGGACGCCAGGTCACCACAGGG - Intronic
1077288177 11:1776822-1776844 GTGGGCCTCAGGTCATCACAGGG - Intergenic
1077928089 11:6702454-6702476 GTGGGCCCAATGTAATCACAAGG + Intergenic
1078415339 11:11160307-11160329 ATGGACTCAATGTAATCACAAGG - Intergenic
1078578611 11:12521680-12521702 GTGGTCCCAATGTCATCACAGGG + Intronic
1079043582 11:17080319-17080341 CTGGCCTCCATGTCATCTCAGGG + Intronic
1079429408 11:20374621-20374643 GTGGGCCCAATGTAATCACAAGG - Intronic
1080403882 11:31961415-31961437 GTGAACTCAGTGTAATCACAAGG - Intronic
1080788709 11:35499893-35499915 GTGGAACCAATGTAATCACAAGG + Intronic
1081132656 11:39399481-39399503 GTGGAAGCCATCTCTTCACAGGG + Intergenic
1081297719 11:41411863-41411885 CAGGACTCCATTGCATCACAAGG - Intronic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1081983007 11:47281665-47281687 GTGGACTGCAGGTCATTAGAAGG - Exonic
1083389285 11:62336307-62336329 GTGGGCCCAATGTCATCCCAAGG + Intergenic
1084641773 11:70430523-70430545 GTGGACCCAATGTAATCACAAGG - Intronic
1085213441 11:74804212-74804234 CTGGACACCATTCCATCACAGGG - Intronic
1085278077 11:75312667-75312689 GTGGGCCCAATGTCATCACAAGG + Intronic
1086116107 11:83252606-83252628 GTGGACTACATGTAATCACACGG - Intronic
1086537457 11:87865301-87865323 GTGGTCTCCAGGTAATCACAAGG + Intergenic
1089121755 11:116140938-116140960 GTGGACCCAGTGTAATCACAAGG - Intergenic
1089216851 11:116839350-116839372 GTGGGCCCATTGTCATCACAGGG + Intergenic
1089839136 11:121399179-121399201 GTGGGCTCAATGTGATCACAAGG + Intergenic
1090059907 11:123455484-123455506 GTGGAATGCATATCATCAGAAGG - Intergenic
1092118619 12:6027497-6027519 GTGGGCTGAATGTCATCACAGGG + Intronic
1092395093 12:8118921-8118943 AGGAACTCCATGTCTTCACATGG - Intergenic
1092519974 12:9260581-9260603 GTGGGCCCAATGTAATCACAAGG + Intergenic
1092673376 12:10888194-10888216 GTGGACTCAATGTAACCATAAGG - Intronic
1092845371 12:12579994-12580016 GTGGACCCAATATAATCACAAGG - Intergenic
1092863950 12:12743742-12743764 GTGGACCCAATGTAATCACAAGG + Intronic
1093485837 12:19651440-19651462 GTGGGCTCAACGTAATCACAAGG + Intronic
1093558241 12:20504807-20504829 GTGGGCCCAATGTTATCACAAGG - Intronic
1093695476 12:22155400-22155422 GTGGGCTCAGTGTAATCACAGGG - Intronic
1093908601 12:24720689-24720711 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1094302600 12:28982376-28982398 TTGGACTCCATTTCTTCACTTGG + Intergenic
1095301755 12:40592521-40592543 GTGGGCCCAATGTAATCACAAGG + Intergenic
1095906877 12:47387785-47387807 ATGGACCCAATGTCATCACCAGG + Intergenic
1098034413 12:66287658-66287680 GTGGGCCCGATGTAATCACAAGG + Intergenic
1098205581 12:68105915-68105937 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1098451089 12:70618723-70618745 GTGGATTGCGTGTCTTCACAAGG - Intronic
1099680348 12:85820061-85820083 GTGGCCTGCATGTGATCAAAGGG - Intronic
1099737209 12:86585581-86585603 GAGAACTTCAAGTCATCACATGG - Intronic
1099784597 12:87244787-87244809 GTGGACCCAGTGTAATCACAAGG + Intergenic
1100108354 12:91206116-91206138 GTGGACTCAATGTAATCACAAGG - Intergenic
1100677715 12:96886346-96886368 GTGGTCCCAATGTCATCACAAGG - Intergenic
1100700100 12:97138215-97138237 GTGGGCCCAATGTAATCACAAGG - Intergenic
1100714673 12:97293448-97293470 GTGGGCTCAATGTAATCACAGGG - Intergenic
1101339182 12:103826384-103826406 GTGGACCCAATGTAATCACAAGG + Intronic
1101540488 12:105660536-105660558 GTGAACTCTGTGTCCTCACATGG + Intergenic
1101740831 12:107498694-107498716 GTGGGCCCAATGTTATCACAAGG - Intronic
1102150307 12:110685149-110685171 GTGGACCCAATGTCATCAGAGGG + Intronic
1102151293 12:110690245-110690267 GTGGATCCCATATAATCACAGGG - Intronic
1102185831 12:110947968-110947990 GTGGGCCTGATGTCATCACAAGG - Intergenic
1102391137 12:112549647-112549669 GTGGACTCAATGTAATCACAAGG - Intergenic
1102495409 12:113315885-113315907 GTGGGCCCAGTGTCATCACAGGG - Intronic
1103021079 12:117534757-117534779 GTGGGCTCAATGTCACCACAAGG + Intronic
1103970816 12:124670328-124670350 GTGGGCCCAAGGTCATCACAAGG - Intergenic
1104063494 12:125287243-125287265 GTGGGCATGATGTCATCACAAGG - Intronic
1104091740 12:125523445-125523467 GTGGGCCCCATGTCATCACAAGG - Intronic
1104392392 12:128402026-128402048 GTGGCCCTGATGTCATCACAGGG + Intronic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1104607995 12:130203936-130203958 GTGGACCCGATGTCATCACGGGG + Intergenic
1107173762 13:37376538-37376560 GTGGTCTCAATGTAATCACAGGG + Intergenic
1107653569 13:42569219-42569241 GTGGGCCCAATGTAATCACAAGG + Intronic
1107752617 13:43585104-43585126 ATGGACTCTATGTAATCACAAGG + Intronic
1107884947 13:44867459-44867481 GTGGGCTCCATGTAATTGCAAGG - Intergenic
1108949676 13:56075329-56075351 GTGGGCCCAATGTCATCACAAGG - Intergenic
1109575285 13:64248821-64248843 GTGGACTTCATGTCCTGACCTGG + Intergenic
1110408369 13:75176120-75176142 GTGGACCCAATGTAAACACAAGG + Intergenic
1110849011 13:80223127-80223149 TTGGGCCCAATGTCATCACAAGG - Intergenic
1111107299 13:83663619-83663641 GTGACCTCCATGTATTCACAAGG - Intergenic
1111843064 13:93473637-93473659 GGGGACTTCAGGTCCTCACAGGG + Intronic
1113971714 13:114196284-114196306 AGGGATTCCATGTCAGCACACGG - Intergenic
1114345902 14:21794799-21794821 GTGGACTCAGTCTAATCACATGG + Intergenic
1115373874 14:32651607-32651629 GTGAACTCTGTGTCCTCACATGG + Intronic
1115901108 14:38149116-38149138 GTGGACCCAATGGAATCACATGG + Intergenic
1116963844 14:50994081-50994103 GTGGGCTCAAGGTAATCACAAGG + Intronic
1117254901 14:53967866-53967888 GTGGCCACAATGTAATCACAAGG - Intergenic
1118250627 14:64156814-64156836 GTGGACTGAATGTCTTTACAAGG - Intronic
1118284005 14:64454634-64454656 GAAGAATCCATGTAATCACAGGG + Intronic
1118331889 14:64821775-64821797 GTGGATTCCTTGTCATGACAAGG + Intronic
1119045266 14:71313406-71313428 GTGGACTCAATGTAACCACAAGG - Intergenic
1119112364 14:71986958-71986980 GTGGGCTCCATGTAATCACCGGG - Intronic
1119722365 14:76899829-76899851 GTGAGCTCAATGTAATCACAAGG + Intergenic
1120219833 14:81719572-81719594 GTGGACCCAATGTAATCCCAAGG - Intergenic
1120343892 14:83258981-83259003 GTTGACTCCATGTCTTTTCATGG + Intergenic
1120558693 14:85962527-85962549 GTGAGCTCAATGTCATCACTTGG + Intergenic
1120567887 14:86081982-86082004 GTGGACCCAATGTAATCACCAGG - Intergenic
1120697952 14:87665369-87665391 GTGGACACAATGTAATCACAAGG + Intergenic
1121102672 14:91260903-91260925 GTGGACCCAGTGTCATCACAAGG + Intergenic
1121290797 14:92773367-92773389 GTGGGCCCAATGTAATCACAAGG - Intergenic
1121472930 14:94170337-94170359 GTGGGCTCGGTGTAATCACAAGG - Intronic
1121716999 14:96083502-96083524 GGGAGCTCAATGTCATCACAAGG + Intronic
1121720231 14:96104151-96104173 GTGGGCCCAATGTCATCACAAGG + Intergenic
1121856631 14:97276315-97276337 GTGGACCGGATGTCATCACAAGG + Intergenic
1122020813 14:98836456-98836478 GTGGGCCCAATGTCATCACAAGG - Intergenic
1122034315 14:98936381-98936403 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122414469 14:101542265-101542287 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1122753575 14:103958548-103958570 GTGGGCCTAATGTCATCACAGGG + Intronic
1123948281 15:25249436-25249458 CTGGACACCAAGTCAACACAGGG - Intergenic
1124694696 15:31854275-31854297 GTGGGCCCCAGGTCATCACAAGG - Intronic
1125472843 15:40021473-40021495 GTGGGCCCCACGTAATCACAGGG - Intronic
1127612927 15:60654669-60654691 GTGGGCTCAATGTAATCACAGGG + Intronic
1129223292 15:74148011-74148033 GTGGACTCAATGTGATCACTAGG - Intergenic
1130221872 15:82026299-82026321 GTGGACCCACTGTAATCACAAGG - Intergenic
1131771502 15:95742805-95742827 GTGGGCCCAATGTAATCACAAGG - Intergenic
1132045720 15:98561507-98561529 GTGGGCTCAATGTAAACACAAGG - Intergenic
1133526284 16:6609052-6609074 ATGGGCTCCAGGTAATCACAAGG - Intronic
1134661253 16:15986290-15986312 GTGGGCCCAATGTAATCACAGGG - Intronic
1134830426 16:17318380-17318402 GAGGAGTACATTTCATCACAAGG + Intronic
1135353087 16:21746460-21746482 GTGGGCCCAATGTAATCACAAGG + Intronic
1135451574 16:22562583-22562605 GTGGGCCCAATGTAATCACAAGG + Intergenic
1135913658 16:26583585-26583607 GTGGGCCCCATGTAATCACCAGG - Intergenic
1135925088 16:26686969-26686991 GTGGACCCAGTGTCATCACAAGG - Intergenic
1136276427 16:29181690-29181712 CTGGCCTCCCGGTCATCACAGGG + Intergenic
1137845698 16:51685775-51685797 GTGGGCTCAATGTAATCAGAAGG - Intergenic
1137882278 16:52062504-52062526 AAGGGCTCAATGTCATCACAGGG - Intronic
1138717044 16:59035594-59035616 GTGGGATCCATATAATCACAGGG - Intergenic
1140632069 16:76865101-76865123 GTGGACCCAATGTAATTACAGGG - Intergenic
1140697133 16:77546418-77546440 GTGGATTCCAGGTCCTCATAAGG - Intergenic
1140934206 16:79655705-79655727 GTGGGCCCCATGTAATCACATGG + Intergenic
1141035903 16:80625396-80625418 ATGGGCTCAATGTAATCACAAGG - Intronic
1141079000 16:81034654-81034676 ATGGGCCCAATGTCATCACAGGG + Intergenic
1141107591 16:81246245-81246267 GTGGATTCAATGTAATCACAAGG - Intronic
1141487387 16:84349781-84349803 GTGGGTCCAATGTCATCACAAGG + Intergenic
1141741020 16:85893071-85893093 GTGGACTCAATATAATTACACGG + Intergenic
1141919998 16:87129239-87129261 GTGGTCCCAGTGTCATCACAAGG - Intronic
1141978667 16:87535566-87535588 GTGGCCCCAATGTCATCACAGGG - Intergenic
1142080809 16:88147750-88147772 CTGGCCTCCTGGTCATCACAGGG + Intergenic
1142947626 17:3446118-3446140 GTGGGTTCAATGTAATCACAAGG - Intronic
1143262733 17:5612127-5612149 GTGGGCTCAATGTAATCACAAGG + Intronic
1143813117 17:9488507-9488529 GTGGGCCCAATGTCATGACAAGG + Intronic
1144047792 17:11469237-11469259 GCAGGCTCAATGTCATCACAAGG + Intronic
1145218420 17:21069393-21069415 GTGGGTTCAATGTAATCACAGGG + Intergenic
1145732929 17:27206226-27206248 GTGGGCCCAATGTAATCACAAGG - Intergenic
1145792237 17:27634688-27634710 GTGGTCCCAATGTGATCACAAGG - Intronic
1145807128 17:27742569-27742591 GTGGTCCCAATGTGATCACAAGG - Intergenic
1146299556 17:31677609-31677631 ATAGACTCGATGTAATCACAAGG - Intergenic
1146940496 17:36840854-36840876 CTGGAATCTCTGTCATCACATGG + Intergenic
1147020355 17:37526784-37526806 GTGACCCCAATGTCATCACATGG - Intronic
1149937713 17:60825688-60825710 TTGAACTCCATGTCCTCACATGG + Intronic
1151052414 17:70993382-70993404 GAAAACTCCATCTCATCACAAGG + Intergenic
1151800681 17:76377646-76377668 GTGGGGTGAATGTCATCACAGGG + Intronic
1153021179 18:630451-630473 ATGGATTCAATGTAATCACAGGG + Intronic
1153153562 18:2123851-2123873 GTGTTCTTCTTGTCATCACAGGG - Intergenic
1153169614 18:2301047-2301069 GTGGGCTCAATTTTATCACAAGG + Intergenic
1153232326 18:2950724-2950746 TTGGACACCATGTCATCTCTGGG - Intronic
1153435211 18:5061660-5061682 GTGGGCTGAATGTAATCACATGG - Intergenic
1153517619 18:5918806-5918828 AAGGACTCAATGTCATCACAAGG + Intergenic
1153726147 18:7957543-7957565 GGTGACTCCATGCCAGCACAGGG - Intronic
1153809971 18:8743729-8743751 GTGGACCCAATGCCATCATAGGG - Intronic
1155026630 18:21946524-21946546 GTCGACCTGATGTCATCACAAGG - Intergenic
1155306088 18:24480021-24480043 GTGGATTTCATGTGATCACTGGG + Intergenic
1155344764 18:24847396-24847418 GTGGACCCAATGTAATCACAAGG + Intergenic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1157211174 18:45743213-45743235 ATGGACCCAATGTAATCACAAGG - Intronic
1157428994 18:47607968-47607990 GTGGGCCCAATGCCATCACAAGG - Intergenic
1158031011 18:52965034-52965056 GTGGCCTCAATGTAAACACAAGG - Intronic
1158868261 18:61659023-61659045 GTGGACCCAATGTAATCACAAGG + Intergenic
1158968190 18:62642190-62642212 GTGGGCCCAATGTAATCACAAGG + Intergenic
1159871862 18:73767459-73767481 GTGGTCCCAATGTGATCACAGGG - Intergenic
1160015982 18:75141109-75141131 GTGGACTGGATGTAATCACAGGG + Intergenic
1160325655 18:77945136-77945158 GTGGACCCAGTGTCATCACAGGG - Intergenic
1160408295 18:78658191-78658213 GTGGACTCCATCACACCTCATGG - Intergenic
1160572355 18:79827035-79827057 GGGGACGCCACGTCCTCACAAGG - Intergenic
1160812394 19:1018418-1018440 GGGGACTCCATGCCAGCTCAGGG + Intronic
1161116946 19:2502671-2502693 GTAGGCCCAATGTCATCACAGGG - Intergenic
1161340600 19:3739874-3739896 GGGGACCCGATGTCCTCACAGGG - Intronic
1161953702 19:7481546-7481568 GTGGTCCCCATGTCATCATAGGG + Intronic
1162085113 19:8244032-8244054 GTGAACCCAGTGTCATCACAAGG + Intronic
1165501181 19:36190655-36190677 GTGGACACAATGTATTCACAAGG + Intronic
1167192528 19:48001472-48001494 ATGGACCCAATGTCATCACAAGG - Intronic
1167285723 19:48597981-48598003 GTGGGCTCAGTGTCATCACCTGG - Intronic
1167490521 19:49790339-49790361 GTGGACCCAATGTCATCACAGGG - Intronic
1168010532 19:53527469-53527491 GTGGGCCCAATGTAATCACAGGG + Intronic
925249647 2:2421582-2421604 GTGGCCCCCATGCCATCCCAGGG + Intergenic
926558453 2:14388106-14388128 GTGGGCTCAATGTAATAACAAGG - Intergenic
927042477 2:19243562-19243584 GTGGGCCCAATGTAATCACAAGG + Intergenic
927699031 2:25256294-25256316 GTGGGCTTCATGATATCACACGG - Intronic
927828679 2:26329045-26329067 GTGGGCCCAATGTAATCACAAGG + Intronic
928364907 2:30692886-30692908 GTGGGCTCAATGGAATCACAAGG + Intergenic
928650765 2:33401271-33401293 GTGGGCCCAATGTAATCACAAGG + Intergenic
929055012 2:37869129-37869151 GTGAGCTCAATGTAATCACAAGG - Intergenic
929488981 2:42379821-42379843 GTGGGCTCAGTGTAATCACAGGG - Intronic
929572806 2:43033282-43033304 GTGGACCTCATGGAATCACAAGG + Intergenic
930450307 2:51527605-51527627 GTAGGCTCAATGTAATCACAAGG - Intergenic
930521440 2:52471786-52471808 GCAGAATGCATGTCATCACAGGG - Intergenic
930603166 2:53465455-53465477 GTGGGCCCAATGTAATCACAAGG - Intergenic
931019985 2:58033318-58033340 GTGGGCACAATGTAATCACAAGG + Exonic
932942946 2:76190593-76190615 TTGGACCCCGTGTAATCACAGGG - Intergenic
933298976 2:80521532-80521554 GTGGGCCCAATGTAATCACAAGG + Intronic
933407004 2:81873336-81873358 GTGGGCCCAATGTAATCACAAGG - Intergenic
933717956 2:85375966-85375988 GTGGGCCCAATGTCATCAGAAGG - Intronic
935679932 2:105627230-105627252 GAGGACTCAATGTGATCCCAAGG - Intergenic
936506099 2:113108511-113108533 GTGGACCCAATCTAATCACAAGG - Intronic
936924386 2:117721719-117721741 GTGGACCCAGTGTAATCACAGGG + Intergenic
937231427 2:120400264-120400286 GTGGACACCATGCCAGCAGATGG - Intergenic
938615208 2:132990598-132990620 TTGGGCTCCATATCATCACAGGG + Intronic
938741840 2:134239579-134239601 GCGGGCTCAATGTCATCACAGGG - Intronic
938977029 2:136489047-136489069 TTGGATTCCATGTCCTCAGATGG - Intergenic
939141386 2:138358642-138358664 ATGAACCCCATGTCATCAAAAGG + Intergenic
939410698 2:141820977-141820999 GTGGGCCCAATATCATCACAAGG + Intronic
939422796 2:141995445-141995467 GTGGGCCCAATGTAATCACAGGG - Intronic
939649266 2:144741684-144741706 GTGGACCCAATGTAATCACGAGG + Intergenic
940341704 2:152588375-152588397 ATGGGCCCAATGTCATCACAAGG - Intronic
941170223 2:162126992-162127014 GTGGGCCCAATGTAATCACAGGG + Intergenic
941573682 2:167203058-167203080 GTGGGTTCAATGTAATCACAAGG - Intronic
942962415 2:181847672-181847694 TTGGACTTCATGTCATAATATGG - Intergenic
943116815 2:183683072-183683094 GTGGGCCCAATGTAATCACAAGG + Intergenic
943187745 2:184634452-184634474 GTGGGCCCAATGTAATCACAAGG + Intronic
943335709 2:186611181-186611203 GTGGACTCATTATAATCACAAGG - Intronic
944659629 2:201910581-201910603 GTGGGCCCAATGTTATCACAGGG + Intergenic
944944583 2:204668853-204668875 GTGGGCTCAGTGTAATCACAGGG + Intronic
945221580 2:207489457-207489479 GTGGGACCCATGTAATCACAAGG - Intergenic
945322002 2:208435433-208435455 GTGGGTTCCATGTGATCATACGG + Intronic
945352343 2:208796096-208796118 GTGGGCCCAATGTAATCACAAGG + Intronic
945985264 2:216348530-216348552 GGGGACTTCCTGACATCACATGG - Intronic
946181621 2:217952533-217952555 GTGGTGTCCATGTCCTCACCAGG - Intronic
946473021 2:219980582-219980604 GTGGGCCCAATGTAATCACAAGG + Intergenic
947584811 2:231348190-231348212 GTGGACCCAATGTAATCACAAGG + Intronic
947944505 2:234090061-234090083 GTGGACCCAATGTAACCACAAGG - Intergenic
948061214 2:235044472-235044494 GTGGACTCCGTTCTATCACAGGG - Intronic
948114615 2:235485197-235485219 GTGGGCTCTGTATCATCACAGGG + Intergenic
948435195 2:237948536-237948558 GTGGGCCCAATGTCGTCACAAGG - Intergenic
948668149 2:239549116-239549138 GTGGGCTCGATGCCATCAAAGGG - Intergenic
949010357 2:241674848-241674870 GTGGGCCCAGTGTCATCACAGGG - Intergenic
1169409597 20:5356359-5356381 GTGGACCCACTGTAATCACAAGG + Intergenic
1169450299 20:5705249-5705271 GTGGGTACAATGTCATCACATGG - Intergenic
1170407897 20:16058823-16058845 GAGGGCACCATGACATCACAGGG - Intergenic
1170758865 20:19231418-19231440 GTGGGCTCCGTGCAATCACATGG + Intronic
1170806016 20:19632520-19632542 GTGAACTTTATGTAATCACAAGG - Intronic
1172933726 20:38603937-38603959 GTGGGCCCAATGTCATCACAAGG - Intronic
1173488040 20:43456050-43456072 GTGGGCCCCATGTGATCATAAGG - Intergenic
1174627895 20:51930355-51930377 GTGGGCCCAATGTAATCACAAGG - Intergenic
1174856479 20:54050219-54050241 GTGGACCCAGTGTGATCACAAGG - Intronic
1175146630 20:56901430-56901452 GTGGGCCCGATGTCATCTCAAGG + Intergenic
1175148473 20:56914232-56914254 ATGGACTCTATGTAATTACAAGG + Intergenic
1175182657 20:57159583-57159605 GTGAGCCCCATGTCATCACAGGG + Intergenic
1175249043 20:57597934-57597956 GTGGCCTCGATGTCATCACAGGG + Intergenic
1175298568 20:57926870-57926892 TTGGACTCCATGTACCCACAAGG - Intergenic
1175495984 20:59414587-59414609 GTGGGCCCAATGTCATCACAAGG - Intergenic
1175677726 20:60961170-60961192 GGAGCCTCCATGTCATCAGAGGG + Intergenic
1176157606 20:63629764-63629786 GGTGGCCCCATGTCATCACAAGG - Intergenic
1176295172 21:5068091-5068113 GTGGGCGCCAGGTCATCACAGGG - Intergenic
1176878173 21:14156273-14156295 GTGGACCCAATGTAATCACAAGG + Intronic
1176978636 21:15353527-15353549 GTGAGCTCCATGTGATCACATGG + Intergenic
1177770733 21:25512782-25512804 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1178065125 21:28896070-28896092 GTGGGTTCAATGTCATCAGAAGG + Intergenic
1178984284 21:37289616-37289638 GTGGGCTCAAAGTCATCATAAGG + Intergenic
1179224209 21:39439085-39439107 GTGGACCTAATGTAATCACATGG + Intronic
1179437076 21:41369459-41369481 GGGCAGTCCAGGTCATCACAGGG + Intronic
1179559748 21:42207822-42207844 ATGGTCTTCATGACATCACAGGG + Intronic
1179861877 21:44194037-44194059 GTGGGCGCCAGGTCATCACAGGG + Intergenic
1181108808 22:20589764-20589786 GTGTCCTCCATGTGCTCACAGGG - Intergenic
1181630681 22:24149670-24149692 GTGGACTCCACCCCATCACTGGG + Intronic
1181975715 22:26727930-26727952 GTGAACTCTGTGTCCTCACATGG + Intergenic
1182739519 22:32557334-32557356 GTGGACTCCATCCCCTCACTGGG - Intronic
1183207332 22:36428495-36428517 GTGGGCCCAATGTAATCACAGGG - Intergenic
1184618039 22:45651428-45651450 GTGGGCCCAATGTAATCACAGGG + Intergenic
1184745616 22:46454056-46454078 GTGGCCCCAAAGTCATCACAAGG + Intronic
1185045162 22:48525089-48525111 GTGGGCTCCAACTCATCACAAGG - Intronic
949204129 3:1417595-1417617 GTGGACCCAATGTAGTCACAAGG + Intergenic
949420713 3:3862941-3862963 GTGGGCCCAATGTAATCACAAGG + Intronic
949438580 3:4056037-4056059 GTGGGCCCAATGTAATCACAAGG - Intronic
949898171 3:8785919-8785941 GTGGGACCCATGTAATCACAAGG + Intronic
950550587 3:13663737-13663759 GTGGGCCCAATGTGATCACAAGG - Intergenic
950685598 3:14616494-14616516 CAGGCCTCCTTGTCATCACAGGG - Intergenic
950916662 3:16652825-16652847 GTGGACTCAACATAATCACAGGG + Intronic
951814776 3:26741899-26741921 GTGGGCTGAATGTAATCACAAGG + Intergenic
952288545 3:31992626-31992648 GTGTGCTCAATGTAATCACAAGG - Intronic
953551032 3:43903213-43903235 GTAGAACCAATGTCATCACAAGG + Intergenic
953654359 3:44837451-44837473 GTGGACTCCATTTCACCTTATGG - Intronic
954590145 3:51776101-51776123 GGGGACACCATGTCATCTGAGGG + Intergenic
954924316 3:54218899-54218921 GTGGACTCAGTGTAGTCACAAGG - Intronic
956163917 3:66382190-66382212 GTGGCCTCCAGGTCTTTACAGGG - Intronic
956229037 3:66992423-66992445 GTGGGCTCATTGTGATCACATGG - Intergenic
956380572 3:68660595-68660617 GTGGGCCCAATGTCATCACAAGG + Intergenic
956512748 3:70012357-70012379 GTGGGCTCAATGTCATCACAAGG + Intergenic
956586393 3:70869671-70869693 GTGGGCGCAATGTAATCACAGGG + Intergenic
957510766 3:81184913-81184935 GTGGGCCCAATGTAATCACAGGG + Intergenic
957978418 3:87476114-87476136 GTGGGCCCAATGTAATCACAAGG - Intergenic
958476514 3:94590848-94590870 GTGGACCCAATGTAATCACATGG - Intergenic
958635831 3:96744480-96744502 GTGGTCCCAATGTAATCACAAGG - Intergenic
959029510 3:101281721-101281743 GTAGGCTCCATGTAATCACAGGG + Intronic
960027046 3:113021159-113021181 ATGGGCTCAATGTAATCACAAGG - Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
961535180 3:127566273-127566295 CTGGACTCCATGGCAACACAAGG + Intergenic
961607630 3:128108889-128108911 GTACACTGCATGTAATCACATGG + Intronic
963169811 3:142239603-142239625 ATGGGCTCAATGTAATCACAAGG + Intergenic
963382678 3:144551895-144551917 GTGGGCTCAATGTAATCACGAGG - Intergenic
963826353 3:149958469-149958491 GTGAGCTCAATGTGATCACAAGG - Intronic
963994954 3:151697743-151697765 GTGGTTTCAATGTAATCACAAGG - Intergenic
964292396 3:155195760-155195782 CTGGACTCCATGTCCTCATCTGG + Intergenic
964609001 3:158589950-158589972 GTGGGCCCAATGTAATCACAAGG - Intronic
964621572 3:158724409-158724431 GTGGGCACAATGTAATCACAAGG + Intronic
965041202 3:163509056-163509078 GTGGACTCCATGTTAACCCAGGG - Intergenic
965837829 3:172870594-172870616 ATGGCCTCAATGTAATCACAAGG - Intergenic
965878941 3:173364863-173364885 GTGGACTCAATGTAATTACAAGG - Intergenic
968805027 4:2766738-2766760 GTGATCCCAATGTCATCACAGGG + Intergenic
969072821 4:4553047-4553069 GTGGGCCCAATGTCATGACAGGG - Intergenic
969258857 4:6021339-6021361 GTGGAGCCCAGGTCTTCACACGG - Intergenic
969309058 4:6341672-6341694 ATGGGCCCAATGTCATCACAAGG + Intronic
969342750 4:6552617-6552639 GTAGGCCCAATGTCATCACAGGG - Intronic
969863137 4:10053291-10053313 GTGGATCCACTGTCATCACAAGG + Intronic
970886653 4:20994039-20994061 GTGGGCCCAATGTAATCACAAGG - Intronic
971778235 4:30995873-30995895 GTGGACTCAATGTAATCAAAGGG - Intronic
973184657 4:47311461-47311483 GTGGGCCCAATGTAATCACAAGG + Intronic
973334070 4:48938324-48938346 GTGGACCCAATGTAATTACAAGG + Intergenic
974362528 4:60900785-60900807 GGTGAGTCCATGTAATCACAAGG + Intergenic
975566081 4:75755843-75755865 GTGGACCCAGTGTTATCACAGGG + Intronic
976830719 4:89310549-89310571 GTGGACCCCATGTCATTACAGGG - Intergenic
977349460 4:95862802-95862824 GAGGACTCCCTCCCATCACAAGG + Intergenic
978447800 4:108797261-108797283 GTGGGCTCAATGTAATCACAAGG + Intergenic
978630110 4:110734359-110734381 GTGGACCCAATGTAATCACAAGG - Intergenic
979344549 4:119571369-119571391 GTGGGCCCAATGTAATCACAAGG + Intronic
979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG + Intronic
980095413 4:128484917-128484939 GGGTTCTCCATTTCATCACAGGG + Intergenic
981799039 4:148635015-148635037 GTGGGCTCCATGTCAAAGCATGG - Intergenic
981859090 4:149333363-149333385 TTTGTCTCCATGTCTTCACATGG + Intergenic
982359149 4:154500145-154500167 GTGGACCCAATGTAATCCCAGGG + Intergenic
983433132 4:167676504-167676526 GTGAACTCTATGTCCTTACATGG - Intergenic
984050992 4:174865102-174865124 GTGTTCTCCATGTCTTCACATGG - Intronic
984379127 4:178967914-178967936 GTGGACCCAATGTAATCACAGGG + Intergenic
986085981 5:4447355-4447377 GTGGACCCAATGTGACCACAAGG + Intergenic
986649904 5:9953043-9953065 GTGGCCCCCGTGTAATCACAGGG - Intergenic
986907453 5:12512499-12512521 GTGGAAGGCATGTCTTCACAGGG + Intergenic
987030577 5:13973085-13973107 GTGGGCCCAATGTAATCACAAGG + Intergenic
987180966 5:15368123-15368145 ATGGGCCCAATGTCATCACAAGG + Intergenic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
987736287 5:21847618-21847640 GTAGACTCCGTGTAATCACAAGG - Intronic
988075078 5:26341940-26341962 GTGGACCCAATGTAATCACAAGG + Intergenic
988244540 5:28662597-28662619 GTGGACTCAATGGAATCACAAGG - Intergenic
988579091 5:32453592-32453614 GTGGACCCAATGCAATCACAAGG - Intergenic
988915082 5:35883963-35883985 GTGGACCCAGTGTAATCACAAGG - Intergenic
989285059 5:39690007-39690029 GAGGACTTACTGTCATCACAGGG + Intergenic
989309383 5:39996680-39996702 CTTGAGTCAATGTCATCACAGGG - Intergenic
989384029 5:40836879-40836901 ATGGAGTCAATGTAATCACAAGG - Intergenic
989674674 5:43959830-43959852 GTGGATCCAATGTTATCACAGGG - Intergenic
990655135 5:57946664-57946686 GTGGCCTCTATGTAATCACATGG + Intergenic
990737309 5:58878403-58878425 GTGGGCCCAATGTCATCAGAAGG + Intergenic
991221368 5:64223275-64223297 GTAGACCCAATGTAATCACAAGG - Intronic
991417990 5:66411268-66411290 GTGGGCCCCATGTAATCACAAGG + Intergenic
991599321 5:68336685-68336707 GTGAAATCAATGTAATCACAAGG + Intergenic
992031177 5:72722915-72722937 GTGGGCCCAATGTGATCACAAGG + Intergenic
993013549 5:82510538-82510560 GTGGACCCAATGTAATCCCAGGG - Intergenic
993342500 5:86741651-86741673 GTAGACCCAATGTAATCACAGGG + Intergenic
994195682 5:96920386-96920408 ATGGGCTCAATGTCATAACAAGG - Intronic
996389585 5:122945245-122945267 GTGGGCTCAATGTAATCACAAGG - Intronic
996848601 5:127928471-127928493 GTGGACCCAATGTAATCACAAGG - Intergenic
997113186 5:131097698-131097720 GTGGGCCCAATGTAATCACAAGG - Intergenic
997120591 5:131168785-131168807 CTGGACTCAGTGTAATCACAAGG - Intronic
997370753 5:133358163-133358185 GAGGGCTCCATGTAATCATAAGG - Intronic
998328418 5:141302900-141302922 GAGGACTACAGTTCATCACAGGG - Exonic
999638662 5:153648984-153649006 GGGGACACAATGTAATCACAAGG + Intronic
999711499 5:154322434-154322456 GTGGTCCCAATGTAATCACAAGG - Intronic
1000035660 5:157445751-157445773 GTGGACCCAATGTAATCACAAGG - Intronic
1000248257 5:159468369-159468391 ATGGACTCACTGTAATCACAAGG + Intergenic
1000702872 5:164474678-164474700 GTGGGCTCAACGTAATCACAAGG + Intergenic
1000941943 5:167372405-167372427 GTGTACTCCATGTCCTCCCATGG + Intronic
1001907551 5:175485507-175485529 GTTGGCCCAATGTCATCACAAGG - Intronic
1002949104 6:1790963-1790985 GTGGACCCAATGTCATCAAAGGG + Intronic
1003418267 6:5932692-5932714 CTGGGCTCGGTGTCATCACAGGG - Intergenic
1003757873 6:9142460-9142482 GTGGGCCCAATGTAATCACAAGG - Intergenic
1004985498 6:21077881-21077903 GTGGGGTCAATGTAATCACAAGG + Intronic
1005275390 6:24211556-24211578 GTGAACTCAATATAATCACAAGG + Intronic
1006913872 6:37582279-37582301 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1008141713 6:47839565-47839587 GTGGACCCAATTTAATCACAAGG - Intergenic
1008492898 6:52104302-52104324 GTGGGCCCCATGTAATCACAGGG + Intergenic
1008602517 6:53109949-53109971 GTGGGCCCAATCTCATCACATGG - Intergenic
1008918572 6:56817925-56817947 GTGGACTCAATGTAATCAAAAGG + Intronic
1009443927 6:63716831-63716853 GTGGGGTCAATGTAATCACAAGG - Intronic
1009781272 6:68273978-68274000 GTGGGCCCCATATAATCACAAGG - Intergenic
1010296135 6:74198660-74198682 GTGAATTCCATGTCATCCCTAGG + Intergenic
1010321701 6:74518052-74518074 GTGGGCCCAATGTAATCACAGGG + Intergenic
1013722568 6:113048530-113048552 CTGGTCCCAATGTCATCACAAGG - Intergenic
1013959087 6:115876315-115876337 GTGGTCTTCATTTCTTCACAGGG - Intergenic
1014018537 6:116562687-116562709 GTGGGCCCAATGTAATCACAAGG + Intergenic
1014187884 6:118456596-118456618 GTGGGCCCAAGGTCATCACAAGG + Intergenic
1015028500 6:128566698-128566720 GTGGGCCCCATGTAATCACGAGG - Intergenic
1016848919 6:148596793-148596815 TTGGACTTGATGTAATCACATGG - Intergenic
1017123137 6:151042977-151042999 GCGGGCTCCATGCCATCACCTGG + Intronic
1022356283 7:29617655-29617677 GTGGGCCCCATTTAATCACATGG - Intergenic
1022448067 7:30486113-30486135 GTGGGCCCAATGTAATCACAAGG + Intergenic
1022486549 7:30783330-30783352 GTGGGCCCAATGTAATCACAGGG - Intronic
1022917395 7:34971976-34971998 GTGGACCCAATGTAACCACAGGG + Intronic
1023269349 7:38444469-38444491 GTGGGCTCTGTGTCTTCACATGG - Intronic
1023344418 7:39256635-39256657 GTGGACTCAATGTAATCACAAGG + Intronic
1023546671 7:41325018-41325040 GCGGGCTCCGTGTAATCACAAGG - Intergenic
1024356890 7:48422787-48422809 GTGGACTTGATGTAATCAAAAGG + Intronic
1024960653 7:54971157-54971179 GTGGGTCCCATGTAATCACAGGG - Intergenic
1025702816 7:63835567-63835589 GTTCACTCTATGTCTTCACATGG - Intergenic
1026653313 7:72234734-72234756 GTGGACTTCATGTCCGGACACGG - Intronic
1028109203 7:86918711-86918733 GTGGACTCAATGTCTACAAAGGG - Intronic
1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG + Intergenic
1029688881 7:102167363-102167385 GCGGATACCATCTCATCACAGGG - Intronic
1030306009 7:108019372-108019394 GTGGGCCCCGTGTAATCACAAGG - Intergenic
1030360514 7:108590521-108590543 GTGGACCCAGTGTAATCACAAGG + Intergenic
1030552761 7:110984950-110984972 GTGGGCTCAATGTAATCACAGGG + Intronic
1030947738 7:115746236-115746258 GTGGGCTCAGTGTAATCACAGGG - Intergenic
1031514394 7:122683932-122683954 GAGGATGCCATCTCATCACAGGG - Intronic
1031647836 7:124248682-124248704 GTGGCCTCAATGTAATCACAAGG - Intergenic
1032716786 7:134515613-134515635 GTGGGCCCGATGTAATCACATGG - Intergenic
1034407880 7:150917321-150917343 GTGGGCCCAATGTAATCACAAGG + Intergenic
1035152171 7:156883834-156883856 GTGGGCTCTATGTGGTCACAGGG - Intronic
1035181383 7:157091905-157091927 ATGGACCCCATGTCATCCCAGGG + Intergenic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1036152638 8:6312958-6312980 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1037049867 8:14359295-14359317 GTGTACTCAATGTGAACACAGGG - Intronic
1037743672 8:21626934-21626956 GTGGACCCAGTGTAATCACAAGG - Intergenic
1038387374 8:27161490-27161512 GTGGGCCCAATGTAATCACACGG + Intergenic
1038403939 8:27307968-27307990 GTGGGCCCAATGTCATCACAGGG + Intronic
1038673175 8:29598555-29598577 CTAGACCCCATGTCATCACCCGG + Intergenic
1038902713 8:31861994-31862016 GTAGAGTCCATGTGATCACCAGG + Intronic
1039134579 8:34306379-34306401 GTGGCCTCAATGTAATCACAGGG - Intergenic
1041272760 8:56124903-56124925 GTGCATTACCTGTCATCACAGGG - Intergenic
1042274087 8:66985302-66985324 TTGGACTCCATGTCTTCTGATGG + Intronic
1042817679 8:72895274-72895296 GTGGGCCCCAGGTAATCACAAGG + Intronic
1044226874 8:89729276-89729298 GTGTAATCTAGGTCATCACAGGG - Intergenic
1044400029 8:91759653-91759675 GTAGACTCCATGTCTTCTGAGGG - Intergenic
1044565132 8:93654480-93654502 ATGGTGTCCATGTCCTCACATGG + Intergenic
1045237379 8:100365159-100365181 GTGGGCTCAATGTAATCACGAGG + Intronic
1046170509 8:110498856-110498878 GTGGAAGCCATCTCTTCACAGGG - Intergenic
1046845206 8:118907666-118907688 GTGGACCCCATGTAATCACATGG + Intergenic
1047087698 8:121537222-121537244 GTGGACCCAATGTAATAACAAGG + Intergenic
1047124532 8:121945975-121945997 GTGGACTGAATGTGATCACAAGG - Intergenic
1047208907 8:122825018-122825040 GTAGGCTCAATGTGATCACAAGG - Intronic
1047461818 8:125072679-125072701 GTGGACTCAGTGTAATCATAAGG - Intronic
1047467230 8:125128832-125128854 GTGGACCTAATGTAATCACAAGG - Intronic
1047509196 8:125503417-125503439 GTGGCTCCAATGTCATCACAAGG + Intergenic
1047964911 8:130039337-130039359 GTGGACCCAATGTAATCACAGGG + Intergenic
1048324715 8:133430050-133430072 GTGGGCCCAATGTCATCACAAGG - Intergenic
1048489614 8:134880506-134880528 GTGGGCTCAAGGTAATCACAAGG + Intergenic
1048550486 8:135428804-135428826 GAGGTCTCAATGTAATCACAAGG - Intergenic
1049617752 8:143583178-143583200 GTCTTCTCCATGTCTTCACACGG - Intronic
1049617882 8:143583845-143583867 GTGGGCCCACTGTCATCACAAGG + Intronic
1050417353 9:5431562-5431584 ATGGACTCATTGTCATCACAAGG - Intronic
1052561895 9:30094545-30094567 GTCTTCTCCATGTCTTCACATGG + Intergenic
1052752148 9:32502833-32502855 GTTGTCTCTATGTCTTCACATGG + Intronic
1052988583 9:34505394-34505416 GTAGACTCAATGTAATCACAAGG - Intronic
1053214759 9:36261142-36261164 GTGGACCCAATGTAATCACCGGG - Intronic
1055440421 9:76331337-76331359 GTAGACCCAATGCCATCACAAGG + Intronic
1056220697 9:84448260-84448282 GTGGGCCCAGTGTCATCACAGGG + Intergenic
1056299036 9:85222791-85222813 GTGAGCCCCATGTAATCACAAGG - Intergenic
1056665441 9:88577571-88577593 GTGGACACTGTGTCCTCACATGG + Intronic
1057030454 9:91770958-91770980 ATGGTCTCCATGTCAGCTCAGGG + Intronic
1058175352 9:101729558-101729580 GTGTACTCAATGTCATCACAAGG - Intronic
1058790410 9:108438957-108438979 GTGGATCCAATGTAATCACAAGG + Intergenic
1059052829 9:110945887-110945909 GTGGGCTCAGTGTAATCACAGGG - Intronic
1059466135 9:114470018-114470040 GTGGGCCCCGTGTCATCACGGGG - Intronic
1059485504 9:114623722-114623744 GTGGGCCCCATGAAATCACAAGG - Intronic
1061382493 9:130266607-130266629 GTGGACCCCATTTCGTCTCAAGG - Intergenic
1062292260 9:135801424-135801446 GGGAGCCCCATGTCATCACAAGG - Intergenic
1185721674 X:2387585-2387607 GTGGCCACCATGTCATCAGCAGG - Intronic
1185837093 X:3354862-3354884 GTGGACCCCATGTAATTGCAAGG + Intergenic
1186002327 X:5026642-5026664 GTGGGCCCAATGTCATCTCAAGG + Intergenic
1186197086 X:7120284-7120306 GTGGACTCAATATAATCACAAGG + Intronic
1186363959 X:8872471-8872493 GTGAGCCCAATGTCATCACAAGG + Intergenic
1186582992 X:10840876-10840898 GGGGGCTCAATGTCATCACAAGG + Intergenic
1186659651 X:11656732-11656754 GTGGGGCCAATGTCATCACAAGG - Intronic
1186698876 X:12067997-12068019 ATGGACTCCATGTCATCCTGAGG + Intergenic
1186866291 X:13723932-13723954 GTGGACCCAATGTCATGACAAGG + Intronic
1186891231 X:13961080-13961102 GTGGGCCCAATGTCATCACAAGG + Intergenic
1186894890 X:13995761-13995783 GTGGGCCCAATGTCATCACAAGG - Intergenic
1187022561 X:15399464-15399486 GTGGAGTCAATGTCCTCCCAAGG + Intronic
1187509176 X:19902160-19902182 GTAGACTCAATGTAATCACAAGG + Intergenic
1187909716 X:24100221-24100243 GTGGGCCCAATGTCATCACAAGG - Intergenic
1188099217 X:26062239-26062261 GTGGGCCCAATGTCATCACAAGG + Intergenic
1188324016 X:28777286-28777308 GTGGGCTCATTGTAATCACAAGG - Intronic
1188326189 X:28804680-28804702 GTGGGCCCAATGTAATCACAAGG - Intronic
1188355255 X:29182847-29182869 GTGGACTCAGTGTATTCACAGGG + Intronic
1189264290 X:39701889-39701911 GTGTCCTCAATGTAATCACATGG + Intergenic
1189355465 X:40306986-40307008 GCTGGCCCCATGTCATCACAAGG + Intergenic
1189538947 X:41966292-41966314 GTGGACCCAATGTAGTCACAAGG + Intergenic
1189660533 X:43292201-43292223 GTGAACTCAATGTAATGACAAGG + Intergenic
1189722271 X:43932592-43932614 GTGGGCCCAATGTAATCACAAGG + Intergenic
1189722315 X:43932995-43933017 GTGGGCCCAATGTAATCACAAGG - Intergenic
1190425032 X:50327907-50327929 GTGGGCCCAATGTAATCACAAGG + Intronic
1190577871 X:51859699-51859721 GTGGGCCCAATGTAATCACAAGG + Intronic
1190858854 X:54324209-54324231 GTGGACCCAGTGTAATCACAAGG - Intronic
1192093680 X:68187338-68187360 GTGGAATGAATGTAATCACAAGG + Intronic
1192531266 X:71888748-71888770 GTGGGCTCAATGTAATCACAAGG + Intergenic
1192633949 X:72801151-72801173 GAAGGCTCCATGTGATCACATGG + Intronic
1192647761 X:72919650-72919672 GAAGGCTCCATGTGATCACATGG - Intronic
1192730182 X:73795245-73795267 GTGGGCCCAATGTAATCACAGGG + Intergenic
1195839526 X:109157742-109157764 GTGGAAGCCATCTCTTCACAGGG + Intergenic
1196579767 X:117364948-117364970 GTGGGCCCAATGTAATCACAAGG - Intergenic
1197582042 X:128295240-128295262 GTGGAATGCATTTCTTCACAGGG - Intergenic
1197804993 X:130390099-130390121 GTGGACCCAATGTCATCACAAGG - Intergenic
1199339862 X:146664276-146664298 TTGGACTCAATTTAATCACAGGG + Intergenic
1199460213 X:148075747-148075769 GTGGTCCCAATGTAATCACAAGG + Intergenic
1199735308 X:150680571-150680593 GTGAACCCAATGTCATTACAAGG + Intergenic
1199759067 X:150891506-150891528 GTGGACCCAATGTAATCACCCGG - Intronic
1199764393 X:150930347-150930369 GTGGGCCCAATGTCATCACAAGG - Intergenic
1201570920 Y:15413558-15413580 GTAGACTCAATATAATCACAAGG + Intergenic