ID: 1155572115

View in Genome Browser
Species Human (GRCh38)
Location 18:27206320-27206342
Sequence CTGGAGGAAAGCAGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155572115_1155572122 1 Left 1155572115 18:27206320-27206342 CCAATTTCCCTGCTTTCCTCCAG No data
Right 1155572122 18:27206344-27206366 AATGTTCACTGCCCAGTCAAGGG No data
1155572115_1155572121 0 Left 1155572115 18:27206320-27206342 CCAATTTCCCTGCTTTCCTCCAG No data
Right 1155572121 18:27206343-27206365 GAATGTTCACTGCCCAGTCAAGG No data
1155572115_1155572125 23 Left 1155572115 18:27206320-27206342 CCAATTTCCCTGCTTTCCTCCAG No data
Right 1155572125 18:27206366-27206388 GAGAGACAGCAAGAAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155572115 Original CRISPR CTGGAGGAAAGCAGGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr