ID: 1155575023

View in Genome Browser
Species Human (GRCh38)
Location 18:27235087-27235109
Sequence CAAGTATTTCACATCTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155575023_1155575025 -4 Left 1155575023 18:27235087-27235109 CCCTTAGAGATGTGAAATACTTG No data
Right 1155575025 18:27235106-27235128 CTTGAAAGAATACTGAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155575023 Original CRISPR CAAGTATTTCACATCTCTAA GGG (reversed) Intergenic
No off target data available for this crispr