ID: 1155575384

View in Genome Browser
Species Human (GRCh38)
Location 18:27240192-27240214
Sequence AAGAGATCACTGCGATACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155575384_1155575387 28 Left 1155575384 18:27240192-27240214 CCTCTGTATCGCAGTGATCTCTT No data
Right 1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155575384 Original CRISPR AAGAGATCACTGCGATACAG AGG (reversed) Intergenic
No off target data available for this crispr