ID: 1155575386

View in Genome Browser
Species Human (GRCh38)
Location 18:27240222-27240244
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155575386_1155575387 -2 Left 1155575386 18:27240222-27240244 CCTCACATAGTTGCAGTGAAGAG No data
Right 1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG No data
1155575386_1155575388 16 Left 1155575386 18:27240222-27240244 CCTCACATAGTTGCAGTGAAGAG No data
Right 1155575388 18:27240261-27240283 ATAGGACTTAGACTCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155575386 Original CRISPR CTCTTCACTGCAACTATGTG AGG (reversed) Intergenic
No off target data available for this crispr