ID: 1155575387

View in Genome Browser
Species Human (GRCh38)
Location 18:27240243-27240265
Sequence AGTAATGAGTCAATAGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155575383_1155575387 29 Left 1155575383 18:27240191-27240213 CCCTCTGTATCGCAGTGATCTCT No data
Right 1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG No data
1155575384_1155575387 28 Left 1155575384 18:27240192-27240214 CCTCTGTATCGCAGTGATCTCTT No data
Right 1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG No data
1155575385_1155575387 2 Left 1155575385 18:27240218-27240240 CCTGCCTCACATAGTTGCAGTGA No data
Right 1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG No data
1155575386_1155575387 -2 Left 1155575386 18:27240222-27240244 CCTCACATAGTTGCAGTGAAGAG No data
Right 1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155575387 Original CRISPR AGTAATGAGTCAATAGCTAT AGG Intergenic
No off target data available for this crispr