ID: 1155576687

View in Genome Browser
Species Human (GRCh38)
Location 18:27255369-27255391
Sequence CTTACTGTAGAGCCCATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155576686_1155576687 -5 Left 1155576686 18:27255351-27255373 CCTGAGTGAGAGTTAGGACTTAC No data
Right 1155576687 18:27255369-27255391 CTTACTGTAGAGCCCATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155576687 Original CRISPR CTTACTGTAGAGCCCATATT TGG Intergenic
No off target data available for this crispr