ID: 1155578645

View in Genome Browser
Species Human (GRCh38)
Location 18:27277917-27277939
Sequence CTGTGGGGATGGAGAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155578645_1155578651 10 Left 1155578645 18:27277917-27277939 CCAACTTTTCTCCATCCCCACAG No data
Right 1155578651 18:27277950-27277972 AAATTTGCACCCGTTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155578645 Original CRISPR CTGTGGGGATGGAGAAAAGT TGG (reversed) Intergenic
No off target data available for this crispr