ID: 1155583147

View in Genome Browser
Species Human (GRCh38)
Location 18:27335024-27335046
Sequence ATGCACAGAAATTGCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155583147_1155583149 0 Left 1155583147 18:27335024-27335046 CCTGCCTTGCAATTTCTGTGCAT No data
Right 1155583149 18:27335047-27335069 TTTGATCCATGAGTAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155583147 Original CRISPR ATGCACAGAAATTGCAAGGC AGG (reversed) Intergenic
No off target data available for this crispr