ID: 1155583209

View in Genome Browser
Species Human (GRCh38)
Location 18:27335734-27335756
Sequence CAATTTTGGCAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155583205_1155583209 -9 Left 1155583205 18:27335720-27335742 CCTCAGGAAACTCACAATTTTGG No data
Right 1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG No data
1155583200_1155583209 24 Left 1155583200 18:27335687-27335709 CCACAGGCTGTACAGGAAGCATG 0: 551
1: 972
2: 1130
3: 804
4: 686
Right 1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155583209 Original CRISPR CAATTTTGGCAGAAGGTGAA GGG Intergenic
No off target data available for this crispr