ID: 1155583209 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:27335734-27335756 |
Sequence | CAATTTTGGCAGAAGGTGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1155583205_1155583209 | -9 | Left | 1155583205 | 18:27335720-27335742 | CCTCAGGAAACTCACAATTTTGG | No data | ||
Right | 1155583209 | 18:27335734-27335756 | CAATTTTGGCAGAAGGTGAAGGG | No data | ||||
1155583200_1155583209 | 24 | Left | 1155583200 | 18:27335687-27335709 | CCACAGGCTGTACAGGAAGCATG | 0: 551 1: 972 2: 1130 3: 804 4: 686 |
||
Right | 1155583209 | 18:27335734-27335756 | CAATTTTGGCAGAAGGTGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1155583209 | Original CRISPR | CAATTTTGGCAGAAGGTGAA GGG | Intergenic | ||
No off target data available for this crispr |