ID: 1155586537

View in Genome Browser
Species Human (GRCh38)
Location 18:27372773-27372795
Sequence GATGGAGACCTGACTATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155586534_1155586537 22 Left 1155586534 18:27372728-27372750 CCAACTGGTCTGTTAGGTTACTG No data
Right 1155586537 18:27372773-27372795 GATGGAGACCTGACTATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155586537 Original CRISPR GATGGAGACCTGACTATCAG TGG Intergenic
No off target data available for this crispr