ID: 1155587104

View in Genome Browser
Species Human (GRCh38)
Location 18:27379115-27379137
Sequence GAAATGGATTTATTTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155587102_1155587104 -5 Left 1155587102 18:27379097-27379119 CCTTGGTCTAAACAATGTGAAAT No data
Right 1155587104 18:27379115-27379137 GAAATGGATTTATTTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155587104 Original CRISPR GAAATGGATTTATTTACTCC AGG Intergenic
No off target data available for this crispr