ID: 1155589992

View in Genome Browser
Species Human (GRCh38)
Location 18:27416464-27416486
Sequence TAAGTATGATGTTCACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155589992_1155589996 18 Left 1155589992 18:27416464-27416486 CCCTGCAGTGAACATCATACTTA No data
Right 1155589996 18:27416505-27416527 TTTTTTCCCTAAAATTAGGTAGG No data
1155589992_1155589995 14 Left 1155589992 18:27416464-27416486 CCCTGCAGTGAACATCATACTTA No data
Right 1155589995 18:27416501-27416523 AATGTTTTTTCCCTAAAATTAGG No data
1155589992_1155589999 26 Left 1155589992 18:27416464-27416486 CCCTGCAGTGAACATCATACTTA No data
Right 1155589999 18:27416513-27416535 CTAAAATTAGGTAGGTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155589992 Original CRISPR TAAGTATGATGTTCACTGCA GGG (reversed) Intergenic
No off target data available for this crispr