ID: 1155590329

View in Genome Browser
Species Human (GRCh38)
Location 18:27420230-27420252
Sequence ATGCATTTCAAGAAGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155590329_1155590333 11 Left 1155590329 18:27420230-27420252 CCTTCAGTCTTCTTGAAATGCAT 0: 1
1: 1
2: 2
3: 35
4: 283
Right 1155590333 18:27420264-27420286 AGCATCAGCCAAACACTGAATGG 0: 1
1: 0
2: 6
3: 13
4: 183
1155590329_1155590334 16 Left 1155590329 18:27420230-27420252 CCTTCAGTCTTCTTGAAATGCAT 0: 1
1: 1
2: 2
3: 35
4: 283
Right 1155590334 18:27420269-27420291 CAGCCAAACACTGAATGGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155590329 Original CRISPR ATGCATTTCAAGAAGACTGA AGG (reversed) Intergenic
904439342 1:30520129-30520151 ATGAGTTTCAGGAAAACTGATGG - Intergenic
905118251 1:35660914-35660936 AGGCATTGCAAGACCACTGAAGG + Intergenic
905670136 1:39785989-39786011 GTGCATTTCATGAAGACTTGGGG - Intronic
905999243 1:42409746-42409768 AGTCATTTCAAAAAGAGTGATGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907659783 1:56381409-56381431 ATGAATTGGAAGGAGACTGAAGG + Intergenic
908232216 1:62116935-62116957 ATGCATTTAAAGAACAGTGATGG - Intronic
908604994 1:65788503-65788525 GTTGCTTTCAAGAAGACTGAGGG + Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909528430 1:76653607-76653629 ATGGATTTCAAGAAAATTGGTGG - Intergenic
910416998 1:87011998-87012020 ATGCATTGCATGCATACTGAAGG - Intronic
911729750 1:101280637-101280659 TGGCATTTCAAGAAGAAAGAAGG + Intergenic
911941687 1:104055531-104055553 ATGCATTTCATGAATTCTGGTGG + Intergenic
915792257 1:158686062-158686084 ATCCATATCCAGAAGAATGAAGG - Intronic
916182320 1:162096384-162096406 ATTCATGTCAAGAGGCCTGATGG - Intronic
917736497 1:177925874-177925896 ATTCTTTTCAAGAAGAAAGAGGG + Intronic
918126312 1:181587250-181587272 ATAGTTTTCCAGAAGACTGAGGG + Intronic
918740949 1:188129422-188129444 AGGAATTTCAATGAGACTGAAGG + Intergenic
919706652 1:200682634-200682656 ATGAATTTAAAGAAAACTAATGG + Intergenic
920943666 1:210507796-210507818 ATACATTTCAAAATCACTGATGG + Intronic
921176568 1:212600226-212600248 ATGTTTTTCAGGAAGACTGCTGG - Intronic
921367353 1:214386051-214386073 CTGCATTTCAAAAAGAGAGATGG - Intronic
921886792 1:220315135-220315157 ATGCACCTGAAGAAAACTGAGGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923439964 1:234007973-234007995 ATGCATTTAAGGAAAAATGAAGG + Intronic
924078606 1:240367876-240367898 ATGAATTTCAAATAGACTGAAGG - Intronic
924078824 1:240370808-240370830 AATCTTTTCCAGAAGACTGAAGG - Intronic
924693136 1:246371454-246371476 TTAGATTTCAAGAAGACTTAGGG - Intronic
924819288 1:247472953-247472975 ATGTATTTCAAAATGACTGAGGG + Intergenic
1063613654 10:7584208-7584230 ATGCAGTTCAAGAAAAATAAAGG + Intronic
1066022019 10:31313203-31313225 ATGCAGAGCAAAAAGACTGAAGG - Intergenic
1066526048 10:36280892-36280914 CTGCATCTCAAGAAGACTATGGG + Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1069043884 10:63722580-63722602 ATCCATCTCAAGAACGCTGAAGG - Intergenic
1070118442 10:73551851-73551873 ATCCAGTTGAAGAAGACTAAAGG - Intronic
1071790936 10:88953242-88953264 ATGTATTTATAGACGACTGAAGG - Intronic
1071884973 10:89939850-89939872 TTGCCTTTTAAGAAGACAGAAGG + Intergenic
1072325019 10:94289065-94289087 ATGCATTTCAAGAAATGAGAGGG + Intronic
1072746592 10:97944032-97944054 AAGTATTTCAGGGAGACTGAAGG + Intronic
1072748290 10:97957668-97957690 ATCCACTTTCAGAAGACTGAAGG - Intronic
1074921360 10:118017306-118017328 TTGCATTTCAAGAAGGCACACGG + Intronic
1075586132 10:123659495-123659517 ATCACTTTCAAGAACACTGAGGG - Intergenic
1077794118 11:5472841-5472863 ATGCATTTCAAGAAGTCAAAGGG + Intronic
1078791771 11:14550254-14550276 ATACGTTTCAAAAATACTGAAGG + Intronic
1079507045 11:21164726-21164748 ATTCTTGTCAAGAAGATTGAAGG + Intronic
1081496687 11:43618378-43618400 ATGTATTTCAAGAAGAATTTTGG + Intronic
1082959911 11:58908467-58908489 ATGAATTCCATGAAGACTGAAGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084756670 11:71243933-71243955 AAACATTTAAAGAAGAATGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086043463 11:82505857-82505879 ATACTTTTCAAGAAGCCTGGAGG + Intergenic
1086177165 11:83904999-83905021 ATGAATGTCAAGAACAATGAAGG - Intronic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087716847 11:101618027-101618049 ATACATTTCCAGAGTACTGAGGG - Intronic
1088619634 11:111668836-111668858 ATGCAGTTCAAGAAAAATGGTGG + Intronic
1089892569 11:121896106-121896128 AGGAATTTCCAGAAGACTCAGGG - Intergenic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093853178 12:24065794-24065816 ATGCATTTCATGGAGATTAAGGG - Intergenic
1093881285 12:24406825-24406847 ATGCATTTCAAAGAAACAGAAGG + Intergenic
1094186797 12:27652248-27652270 AGGCATTTCCAAAGGACTGAGGG + Intronic
1094288823 12:28822966-28822988 ATGGATCTCTACAAGACTGATGG + Intergenic
1094399762 12:30049668-30049690 ATTCATTTCTAGAAGTCTGGAGG - Intergenic
1095324859 12:40877250-40877272 ATGCAATTCAAGGAAACTCAGGG - Intronic
1095409006 12:41901780-41901802 GTGCATTTCAAAATCACTGAGGG + Intergenic
1096023428 12:48340988-48341010 CTGCATTCCAGGAAGAATGAAGG + Exonic
1096141545 12:49246727-49246749 ATGCATTATCAGAAGACAGAAGG + Intronic
1096780696 12:53990559-53990581 ATGCATTTAAAGGTGACTGGAGG + Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098424292 12:70341885-70341907 CTGTATTGCAAGAATACTGAGGG + Intronic
1098723950 12:73938710-73938732 ATCCATTTTAGGAGGACTGAAGG + Intergenic
1100118835 12:91344414-91344436 TTGCATTTCATAAAGACTGAGGG + Intergenic
1102371836 12:112388326-112388348 AGGCATTTAATGAATACTGAAGG - Intergenic
1102835353 12:116052905-116052927 ATGCATTTCAGTAAAACTGATGG + Intronic
1104615965 12:130268827-130268849 ATGCATTTAAAGCATACTGCCGG - Intergenic
1104651426 12:130537238-130537260 ATGCATTTCAAGCAGACACGAGG + Intronic
1105616206 13:22015271-22015293 ATACATGTCAAAAAGATTGAAGG + Intergenic
1105835610 13:24208556-24208578 ATGCAGATCAAGAAGACTGGTGG + Intronic
1106144860 13:27041314-27041336 ATGCATTTCAGGAAGAGCCAGGG - Intergenic
1107657947 13:42610977-42610999 AGTCAATTCAAGAAGACAGATGG - Intergenic
1108580036 13:51820281-51820303 ATGCATTTCACGAAGGATGTTGG + Intergenic
1109459080 13:62630015-62630037 AGGCATTTGAAGAAAATTGATGG - Intergenic
1109688999 13:65861374-65861396 ATGTATTTCAAGTAGAGGGAAGG - Intergenic
1110247331 13:73341696-73341718 ATTAATTTCAGGAAGGCTGATGG - Intergenic
1110362949 13:74648419-74648441 ATGCATTTTAAGAATACATAAGG - Intergenic
1110744991 13:79041978-79042000 ATAAATTTCAAGATGAGTGAAGG - Intergenic
1111371592 13:87326228-87326250 ATGCAAGCTAAGAAGACTGAGGG - Intergenic
1111381581 13:87460603-87460625 ATGAATTTAAAGAGGACTGGTGG - Intergenic
1111454993 13:88470037-88470059 ATGAATTTCCAGAAGTCTTAAGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111867296 13:93785091-93785113 ATTCATTTCAAGAAGAAAAAGGG + Intronic
1111883326 13:93986336-93986358 ATGCATTTCAAGGCCAATGAAGG + Intronic
1112886692 13:104182234-104182256 ATGCATCTCAGAATGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114914010 14:27239375-27239397 AAGCATCTCTAGAAGAATGAAGG + Intergenic
1115082243 14:29469114-29469136 CAGCATTTCATGAAGACTTAGGG - Intergenic
1115773388 14:36689223-36689245 ATGGGTTTCATGAAGGCTGATGG - Intronic
1116372252 14:44150922-44150944 ATGTATTTGAAGATGACAGAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1119075724 14:71636532-71636554 ATGCAATTAAAGCAGGCTGAGGG + Intronic
1120484880 14:85100605-85100627 GTGCATTCCAAGAAGAAAGAAGG + Intergenic
1120818491 14:88889484-88889506 ATTCATTTAAAAAAGACTTATGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1123098919 14:105782559-105782581 ATGCAGTTGAAGAAGACGCATGG - Intergenic
1126210274 15:46093727-46093749 ATGGATGTCAAGGAGTCTGAGGG - Intergenic
1127080462 15:55373161-55373183 ATGCATTTGGAAAAAACTGAAGG - Intronic
1127599405 15:60520333-60520355 TTGCATTTCAGGAAGAATGAGGG + Intronic
1127896553 15:63305157-63305179 ATTCATTTAAAGAACACTAATGG - Intronic
1128034809 15:64515530-64515552 ATCCATTTCACAAAGGCTGAGGG - Intronic
1128383104 15:67127678-67127700 ATCAATTTCAAAAAGTCTGAAGG - Intronic
1128790910 15:70433254-70433276 ATGCATTGGAAGCTGACTGATGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133594528 16:7278651-7278673 ATTCATATCAAAAAGTCTGAAGG + Intronic
1133603541 16:7363818-7363840 ATAAACATCAAGAAGACTGACGG - Intronic
1135982347 16:27157718-27157740 ATACATTTTAAGGAGACTTAAGG - Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140022813 16:71254919-71254941 ATGCATACCAAAAAGACCGAAGG + Intergenic
1141289227 16:82702315-82702337 ATGTATTTCAAGAACCATGATGG - Intronic
1142322406 16:89392318-89392340 AAGCATTTCAAACACACTGATGG + Intronic
1146601782 17:34223551-34223573 ATACATTTCCAGAAGAATGATGG - Intergenic
1146684991 17:34835593-34835615 AGGCATTTAAAGAAGATTCAAGG + Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1148407232 17:47426360-47426382 ATGCATTTCATGAAAAGTTATGG - Intronic
1149272401 17:54994558-54994580 ATAAAGATCAAGAAGACTGATGG - Intronic
1150125678 17:62632958-62632980 TTACATTTCCAGAGGACTGACGG - Intronic
1153428910 18:4993563-4993585 GTGCATTCCATGAAGTCTGACGG - Intergenic
1154060708 18:11056977-11056999 GTGCATTGAATGAAGACTGAAGG + Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1158168279 18:54566915-54566937 AAACATTTCAAGAAAAATGAAGG - Intergenic
1159510573 18:69393562-69393584 ATGCTTTTATAGAAGTCTGATGG - Intergenic
1159784908 18:72701839-72701861 ATGCATTTCCAGAACCCTGATGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1161823892 19:6549301-6549323 ATGCAATTGAAGAAAACTAATGG + Intergenic
1162262699 19:9545652-9545674 CTACCTTTCCAGAAGACTGAGGG - Intergenic
1166424909 19:42669094-42669116 CTGCATTTCAGGAAGACTGGCGG + Intronic
1168638846 19:58017309-58017331 GTGCATTTCAAGACCCCTGATGG - Intergenic
926099251 2:10103544-10103566 ATGCATGTTTAGAAGCCTGAAGG - Intergenic
927133302 2:20079035-20079057 ATGCATTTCAAGGAGAAGGCTGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929003994 2:37378039-37378061 ATGTTTGTCATGAAGACTGAGGG + Intergenic
929773221 2:44910491-44910513 ATGCATCTCAAGAAGATTACAGG + Intergenic
930763551 2:55061540-55061562 ATATATTTCAAAGAGACTGAGGG - Intronic
931547371 2:63404157-63404179 TTGCATTTGAACAAGACTGCTGG + Exonic
934113149 2:88760598-88760620 ATGCATTTCACGAGATCTGATGG + Intergenic
935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG + Intronic
936253845 2:110891900-110891922 ATGCATTTCAAAAAGGCTTCGGG - Intronic
937746920 2:125425235-125425257 ATCCATGTCAAGAAGACTGCAGG + Intergenic
938705767 2:133924189-133924211 ATGGCTTTCAAGAAGGATGAAGG + Intergenic
939436105 2:142180364-142180386 ATGCTTTTTAAAAATACTGAAGG + Intergenic
941388382 2:164881188-164881210 ATAAATTTCAAGAAGAAGGAAGG - Intergenic
941644062 2:168021131-168021153 ATATATTTAAATAAGACTGATGG - Intronic
942771988 2:179532619-179532641 ATGAGTTTCATGAAGACTGAAGG - Intronic
943449533 2:188030994-188031016 ATACTTTTCAAGAGGATTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944434662 2:199674333-199674355 ATGTAGGTCAAGAAGAATGAAGG + Intergenic
944768921 2:202893591-202893613 ATGCATTTCACAAAGACTTGAGG - Intronic
944777204 2:202978867-202978889 ATGGATCTGAAGAAAACTGAGGG + Intronic
945904234 2:215572811-215572833 CTGAATTTCCAAAAGACTGAAGG - Intergenic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
946479220 2:220037946-220037968 AAACATCTCAAGAAGACAGACGG + Intergenic
946972481 2:225110151-225110173 ATACATTTAAAGAAAACAGATGG - Intergenic
947199568 2:227602380-227602402 AAGAATTTCAAGAAGACTGTTGG + Intergenic
1169595238 20:7190989-7191011 ATGCATTTTAAGAACACTTGAGG - Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1172720038 20:36992915-36992937 ATACATCTCAAGAAATCTGATGG + Intergenic
1173672435 20:44808232-44808254 AAGAATTTCAAGAAGGCTGCTGG + Intronic
1174726192 20:52864661-52864683 TTGCAATTCTACAAGACTGATGG - Intergenic
1178279476 21:31268817-31268839 ATGCATTTCAATAACACTAAAGG + Intronic
1178481164 21:32980200-32980222 ATGCATTTGAGGAAGTATGATGG - Intergenic
1178767020 21:35463916-35463938 ATGCGTTTCATGAAATCTGATGG + Intronic
1179108387 21:38424023-38424045 ATGCATTTCGGGAGGACAGAAGG - Intronic
1179297205 21:40073860-40073882 GAACATTTCAAGGAGACTGATGG + Intronic
1181585495 22:23850691-23850713 AGGCATTTCAAGGAGAATCAAGG + Intergenic
1182090826 22:27593667-27593689 ATGCATTTCCAGAAGGGTGTGGG + Intergenic
1184081920 22:42227831-42227853 TTGCATAAGAAGAAGACTGATGG + Intronic
1184631685 22:45786238-45786260 ATGCTTTTCAAGAATAGTAATGG - Intronic
949781810 3:7698152-7698174 ATGTATGTAAAGAGGACTGAAGG + Intronic
950928532 3:16766811-16766833 ATGAATTTGAGGAAGATTGAAGG + Intergenic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
952552017 3:34489747-34489769 ATGCATTTCATGATGACTGCTGG - Intergenic
955760690 3:62278627-62278649 ATGCATGTCACCAAGACTGGGGG - Intronic
956626678 3:71273542-71273564 CTGCATTCAAGGAAGACTGAAGG - Intronic
957697657 3:83662590-83662612 ATGAATTTCAAGAACACAGAAGG + Intergenic
958829665 3:99072251-99072273 ATCCATTTCAAGGAGCCAGAGGG + Intergenic
960247868 3:115419406-115419428 ATGCATAAAAAGGAGACTGAGGG - Intergenic
960284534 3:115812341-115812363 ATGCATTTCATGAGGAATTAAGG + Intronic
961002748 3:123384924-123384946 AGGGACTTCAAGGAGACTGAAGG - Intronic
963124302 3:141801005-141801027 ATGCATTTCTTGTAAACTGATGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965388587 3:168075737-168075759 AAGCATGTCAAGACGACTCATGG + Intronic
966648419 3:182271882-182271904 ATTCAATTCCAGGAGACTGAGGG - Intergenic
971465072 4:26948712-26948734 AGGCATTTCCAGAATACTGAAGG - Intronic
972191917 4:36603522-36603544 CTCCATTTTAAGAAGAATGATGG - Intergenic
974243768 4:59286534-59286556 ATTCATTTCAAGAATTTTGAAGG + Intergenic
974339440 4:60596032-60596054 ATGCATGTATAGAAAACTGAAGG - Intergenic
974889255 4:67859886-67859908 ATGAAATTCAAGTAGTCTGATGG + Intronic
975870042 4:78769828-78769850 ATGCTTTTAAAAAAGACTGCAGG - Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979347718 4:119608247-119608269 CTGCAGTCCAAGAAAACTGAAGG + Intronic
979644452 4:123052351-123052373 ATGAACTTCAAGAAAACAGACGG - Intronic
981194758 4:141905870-141905892 AGGCATTTTCAGAAGACTCAAGG + Intergenic
981662014 4:147178495-147178517 ATGCATTTTAAGAAAATTGCAGG - Intergenic
981684833 4:147441986-147442008 ATGCATTTATAGAGCACTGAAGG + Intergenic
982063657 4:151630268-151630290 TTCCATTTCAAGAAAACTCATGG - Intronic
982160374 4:152562958-152562980 AAGCATCTCAATAAAACTGAAGG + Intergenic
982402717 4:154985846-154985868 CTGCATACCAAGAAAACTGATGG - Intergenic
983793560 4:171829439-171829461 GTGCATATCAAGAAGACTCGGGG - Intronic
983943402 4:173560028-173560050 AAGCATTTGAAGAAGATTGATGG - Intergenic
984207714 4:176806116-176806138 ATGCAGTTCAAGCAAACTGCAGG - Intergenic
984358094 4:178691139-178691161 AAGACTTTCAAGAAAACTGAGGG + Intergenic
987276695 5:16370639-16370661 AGGCATTGCTAGGAGACTGAAGG - Intergenic
987358849 5:17088548-17088570 AGGCATTTAAAGAAGACTTTTGG + Intronic
990550821 5:56876416-56876438 ATGCATTAGAAAAAGACTGAGGG - Intronic
991963350 5:72067279-72067301 AGGCATCTGGAGAAGACTGATGG - Intergenic
992114451 5:73526276-73526298 TTGCAATGCATGAAGACTGAAGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993942664 5:94079222-94079244 ATGCATTTTAATAAGATTAAAGG - Intronic
994635698 5:102342488-102342510 ATGCATTTCCAGACAAATGAGGG + Intergenic
994910121 5:105894028-105894050 ACGCAGTAAAAGAAGACTGAGGG + Intergenic
996342769 5:122456594-122456616 AAGCATTTCCAGAATCCTGATGG + Intronic
997081908 5:130749117-130749139 ATGCACTTTAAAAATACTGAAGG + Intergenic
999088413 5:148913366-148913388 ATGCATTTCAAGATTCCCGAAGG + Intergenic
1001815687 5:174667527-174667549 ATGTATTTCAAGGAGAGTTAAGG - Intergenic
1001872925 5:175172653-175172675 AAACATTTTAAGAAGACAGATGG + Intergenic
1002010024 5:176271697-176271719 ATACATTTCAAAATGACTGAGGG + Intronic
1002216710 5:177640607-177640629 ATACATTTCAGAATGACTGAGGG - Intergenic
1002448532 5:179305866-179305888 ATGCATTTCTTCAACACTGATGG - Intronic
1002767234 6:252897-252919 ATTCATTTAAACAACACTGAAGG + Intergenic
1004942730 6:20577945-20577967 ATGGATGTCAAGAAGATGGATGG + Intronic
1004985408 6:21077063-21077085 AGGCATTTCAAGAAGTCTTTGGG - Intronic
1005221931 6:23596997-23597019 ATGGATGTTCAGAAGACTGAGGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006479064 6:34277195-34277217 ATGCAATACAAGAAGCCCGAGGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1010709676 6:79159214-79159236 GTGAATTTGAAGAAAACTGAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011388777 6:86827478-86827500 ATGTATAGCAAGAAGACTCAAGG + Intergenic
1012219468 6:96630877-96630899 ATGCTTTGCAGGAAGAATGAGGG - Intergenic
1013118056 6:107116945-107116967 ATACATTCGCAGAAGACTGAGGG + Intergenic
1015534712 6:134255883-134255905 AGCCAACTCAAGAAGACTGAAGG - Intronic
1017013067 6:150077569-150077591 ATGCAGTACAGGAAGACCGAAGG - Intergenic
1017017298 6:150112037-150112059 ATACATTTCAAGAAAAGAGAAGG + Intergenic
1018359302 6:163050602-163050624 ATGTATTTGACTAAGACTGAAGG - Intronic
1018888995 6:167967525-167967547 ATTCAATACAAGGAGACTGATGG - Intronic
1019794880 7:3042335-3042357 ATGCATTAACAGAAGACTGCTGG + Intronic
1019867990 7:3730893-3730915 CTGTATTCCAAAAAGACTGATGG - Intronic
1021328817 7:19308981-19309003 ATGCATTTTAAGAAGTATGTTGG + Intergenic
1022325708 7:29330188-29330210 ATACATTTCAAGATGACTTTAGG - Intronic
1023349872 7:39309596-39309618 GGGCATTTAAAGAAAACTGAAGG + Intronic
1024052772 7:45639457-45639479 ATCCATTTCCAGAAGACTGTGGG + Intronic
1025259813 7:57411334-57411356 ATGCATTCCAAGAAGACTGAAGG + Intergenic
1025769253 7:64488868-64488890 ATGCAATTCAGGAAGACTAGGGG - Intergenic
1027690609 7:81340215-81340237 ATGCCTTTGAACAACACTGATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027921458 7:84400377-84400399 ATGAATTTCAAGAAAACAGATGG + Intronic
1030335398 7:108319922-108319944 ATGTATTTTAAGAAAGCTGAGGG + Intronic
1031693033 7:124814319-124814341 TTGCATTTCATGAAGGCTTAAGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033770637 7:144547592-144547614 ATTCATTTCACAACGACTGATGG + Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036603966 8:10290172-10290194 ATGGCTTTTAAGAAGGCTGAAGG - Intronic
1037077155 8:14734544-14734566 AAGCATTTTAAAAAGACTAATGG - Intronic
1037153254 8:15666003-15666025 ATGAATTTAAAGTAGAATGATGG + Intronic
1037693426 8:21203492-21203514 ATGCATTTCATGATAATTGAGGG + Intergenic
1038767474 8:30442545-30442567 AAGCATTCCAGGAAGACTGCGGG - Intronic
1038970466 8:32627810-32627832 ATGAATTTTAAGAAAATTGAGGG - Intronic
1039681697 8:39745436-39745458 ATTCATTTCAAGTAAAATGAAGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041633496 8:60115891-60115913 ATGCATTTCATGAAGAGCAAGGG - Intergenic
1042998094 8:74723267-74723289 GTGTATTTGAAGAAGAATGATGG - Intronic
1043997011 8:86830293-86830315 ATCCTTCTCAGGAAGACTGAAGG + Intergenic
1044127243 8:88473930-88473952 AGGCACTTCAAGTAGACGGAGGG + Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1047885321 8:129243996-129244018 ATGGATTTGAAAAATACTGAAGG - Intergenic
1048296584 8:133219129-133219151 ATGCTTTGCAAGAACACTCATGG - Intronic
1048399609 8:134051980-134052002 TTGCATTTAAAGAAGGCTGATGG - Intergenic
1048511619 8:135067570-135067592 AAGTATTTCAACAAAACTGAGGG - Intergenic
1050582760 9:7078109-7078131 ATGCATTGGGAGAAGACTCAAGG + Intergenic
1051392877 9:16585758-16585780 ATGCATTACAAGGAGACAGTTGG + Intronic
1051667556 9:19479859-19479881 CTGCAGATAAAGAAGACTGAAGG - Intergenic
1052456622 9:28707414-28707436 ATGCATTTCAGGAGGATGGATGG - Intergenic
1055410425 9:76023196-76023218 ATGCTTTTCCAAAAGACTTACGG + Intronic
1056559547 9:87718245-87718267 ATTTATTTCAAGAAGATTAAAGG - Intergenic
1056832331 9:89927361-89927383 ATCCATTCCAGGAAGGCTGACGG - Intergenic
1057417683 9:94879423-94879445 TTTCATTTCCAGAAGACTGAGGG + Intronic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1061466142 9:130781450-130781472 ACGCATGTCAACATGACTGAGGG - Intronic
1185886644 X:3789270-3789292 CTGCATTTCCAGATGATTGAGGG - Intergenic
1186514808 X:10158873-10158895 ATGCATTCTAAGTAGACAGAGGG + Intronic
1186776093 X:12865906-12865928 ATGCTTTGGAAGAAAACTGATGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187255247 X:17636102-17636124 AAGAATTCCAAGAAGACTGGAGG - Intronic
1187328977 X:18318323-18318345 AAGCTTTTGAAGAAGATTGAAGG - Intronic
1190043169 X:47088626-47088648 AAGGATTTCAACAAGACTCAGGG - Intronic
1190518897 X:51256333-51256355 ATTCATATCAACATGACTGAAGG + Intergenic
1190641604 X:52485723-52485745 ATGCATCCCAAGAAGACTGAAGG - Intergenic
1190643068 X:52498982-52499004 AAGTAGTTCATGAAGACTGACGG - Intronic
1190644605 X:52513885-52513907 AAGTAGTTCATGAAGACTGACGG + Intronic
1190646068 X:52527142-52527164 ATGCATCCCAAGAAGACTGAAGG + Intergenic
1193946783 X:87747253-87747275 ATGCATTTTAACAAGACTTCAGG + Intergenic
1194448513 X:94014895-94014917 ATGAATCTGAGGAAGACTGAGGG - Intergenic
1195279681 X:103319084-103319106 CTGCATTGCAAGAAGTGTGAGGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195929960 X:110064546-110064568 TTGCATTTCCAGAAAACTCATGG - Intronic
1196096724 X:111808487-111808509 ATTCATTGCAAGCTGACTGAAGG - Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197193362 X:123673522-123673544 ATGTATTTAAACAAGAATGAAGG - Intronic
1198112936 X:133518614-133518636 CTGCTTTTCAAAAAGCCTGAAGG - Intergenic
1199120115 X:144041714-144041736 GTTCATTTCAATAAAACTGATGG - Intergenic
1199613949 X:149640336-149640358 AGGCAGTTAAAGAAGACTAAAGG - Intergenic
1199818103 X:151418306-151418328 ATGAATTTTAAGAAAACTTAGGG + Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1201341462 Y:12938433-12938455 AAGCATGTCAGGAAGACTGTTGG - Intergenic
1202168138 Y:22014151-22014173 ATGCCTTTCAAGGAGACTTGGGG + Intergenic
1202194572 Y:22286070-22286092 ATGCAGTGAAAGAAGACAGAAGG + Intergenic
1202223223 Y:22572217-22572239 ATGCCTTTCAAGGAGACTTGGGG - Intergenic
1202319892 Y:23623443-23623465 ATGCCTTTCAAGGAGACTTGGGG + Intergenic
1202550876 Y:26046613-26046635 ATGCCTTTCAAGGAGACTTGGGG - Intergenic