ID: 1155593435

View in Genome Browser
Species Human (GRCh38)
Location 18:27454384-27454406
Sequence GCAGGAAGTGCTGTAGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155593435_1155593448 18 Left 1155593435 18:27454384-27454406 CCCTCCGCTACAGCACTTCCTGC No data
Right 1155593448 18:27454425-27454447 GGTTCCGCACAGGAAGAGGAGGG No data
1155593435_1155593446 14 Left 1155593435 18:27454384-27454406 CCCTCCGCTACAGCACTTCCTGC No data
Right 1155593446 18:27454421-27454443 CCTAGGTTCCGCACAGGAAGAGG No data
1155593435_1155593442 -3 Left 1155593435 18:27454384-27454406 CCCTCCGCTACAGCACTTCCTGC No data
Right 1155593442 18:27454404-27454426 TGCCAGAGGGTTGGAATCCTAGG No data
1155593435_1155593444 8 Left 1155593435 18:27454384-27454406 CCCTCCGCTACAGCACTTCCTGC No data
Right 1155593444 18:27454415-27454437 TGGAATCCTAGGTTCCGCACAGG No data
1155593435_1155593447 17 Left 1155593435 18:27454384-27454406 CCCTCCGCTACAGCACTTCCTGC No data
Right 1155593447 18:27454424-27454446 AGGTTCCGCACAGGAAGAGGAGG No data
1155593435_1155593449 19 Left 1155593435 18:27454384-27454406 CCCTCCGCTACAGCACTTCCTGC No data
Right 1155593449 18:27454426-27454448 GTTCCGCACAGGAAGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155593435 Original CRISPR GCAGGAAGTGCTGTAGCGGA GGG (reversed) Intergenic
No off target data available for this crispr