ID: 1155597061

View in Genome Browser
Species Human (GRCh38)
Location 18:27500454-27500476
Sequence CCTTCTCTGGAGACAAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155597056_1155597061 15 Left 1155597056 18:27500416-27500438 CCTCTAGGACATTATACAATTGA No data
Right 1155597061 18:27500454-27500476 CCTTCTCTGGAGACAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155597061 Original CRISPR CCTTCTCTGGAGACAAATGA TGG Intergenic
No off target data available for this crispr