ID: 1155601041

View in Genome Browser
Species Human (GRCh38)
Location 18:27547975-27547997
Sequence TCTGACCAGCAGTTATTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155601038_1155601041 11 Left 1155601038 18:27547941-27547963 CCATAGCTTTCTAAGCCCTAAAA No data
Right 1155601041 18:27547975-27547997 TCTGACCAGCAGTTATTGACTGG No data
1155601040_1155601041 -5 Left 1155601040 18:27547957-27547979 CCTAAAAAAATGTGCAACTCTGA No data
Right 1155601041 18:27547975-27547997 TCTGACCAGCAGTTATTGACTGG No data
1155601039_1155601041 -4 Left 1155601039 18:27547956-27547978 CCCTAAAAAAATGTGCAACTCTG No data
Right 1155601041 18:27547975-27547997 TCTGACCAGCAGTTATTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155601041 Original CRISPR TCTGACCAGCAGTTATTGAC TGG Intergenic
No off target data available for this crispr