ID: 1155603026

View in Genome Browser
Species Human (GRCh38)
Location 18:27571177-27571199
Sequence TAAAATCCACAACTTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155603021_1155603026 20 Left 1155603021 18:27571134-27571156 CCCTACAACTCTTATATCTTCAA No data
Right 1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG No data
1155603023_1155603026 -9 Left 1155603023 18:27571163-27571185 CCTTTCTTCATATTTAAAATCCA No data
Right 1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG No data
1155603022_1155603026 19 Left 1155603022 18:27571135-27571157 CCTACAACTCTTATATCTTCAAT No data
Right 1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155603026 Original CRISPR TAAAATCCACAACTTGGGCA TGG Intergenic
No off target data available for this crispr