ID: 1155603886

View in Genome Browser
Species Human (GRCh38)
Location 18:27581611-27581633
Sequence GCTTTTAAGGAGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155603886_1155603890 -2 Left 1155603886 18:27581611-27581633 CCCTCCATGATCTCCTTAAAAGC No data
Right 1155603890 18:27581632-27581654 GCTCCAAGCCAGAACTCTTCAGG No data
1155603886_1155603891 -1 Left 1155603886 18:27581611-27581633 CCCTCCATGATCTCCTTAAAAGC No data
Right 1155603891 18:27581633-27581655 CTCCAAGCCAGAACTCTTCAGGG No data
1155603886_1155603895 14 Left 1155603886 18:27581611-27581633 CCCTCCATGATCTCCTTAAAAGC No data
Right 1155603895 18:27581648-27581670 CTTCAGGGAGACAGATTTGAGGG No data
1155603886_1155603894 13 Left 1155603886 18:27581611-27581633 CCCTCCATGATCTCCTTAAAAGC No data
Right 1155603894 18:27581647-27581669 TCTTCAGGGAGACAGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155603886 Original CRISPR GCTTTTAAGGAGATCATGGA GGG (reversed) Intergenic
No off target data available for this crispr