ID: 1155605427

View in Genome Browser
Species Human (GRCh38)
Location 18:27600357-27600379
Sequence GTGAAAAATTCCACAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155605427_1155605429 20 Left 1155605427 18:27600357-27600379 CCATCAGCTGTGGAATTTTTCAC No data
Right 1155605429 18:27600400-27600422 AGCCATAATCTAACCCTCTTGGG No data
1155605427_1155605428 19 Left 1155605427 18:27600357-27600379 CCATCAGCTGTGGAATTTTTCAC No data
Right 1155605428 18:27600399-27600421 GAGCCATAATCTAACCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155605427 Original CRISPR GTGAAAAATTCCACAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr