ID: 1155605911

View in Genome Browser
Species Human (GRCh38)
Location 18:27605985-27606007
Sequence TCACTTGGCAGATTGATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155605911_1155605919 15 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605911_1155605920 21 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data
1155605911_1155605913 -4 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605913 18:27606004-27606026 GTGAGCCCCATATTTCTGCCTGG No data
1155605911_1155605917 8 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605917 18:27606016-27606038 TTTCTGCCTGGAGCTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155605911 Original CRISPR TCACTTGGCAGATTGATTCA AGG (reversed) Intergenic