ID: 1155605913

View in Genome Browser
Species Human (GRCh38)
Location 18:27606004-27606026
Sequence GTGAGCCCCATATTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155605910_1155605913 0 Left 1155605910 18:27605981-27606003 CCATCCTTGAATCAATCTGCCAA No data
Right 1155605913 18:27606004-27606026 GTGAGCCCCATATTTCTGCCTGG No data
1155605909_1155605913 6 Left 1155605909 18:27605975-27605997 CCAGAACCATCCTTGAATCAATC No data
Right 1155605913 18:27606004-27606026 GTGAGCCCCATATTTCTGCCTGG No data
1155605908_1155605913 11 Left 1155605908 18:27605970-27605992 CCTATCCAGAACCATCCTTGAAT No data
Right 1155605913 18:27606004-27606026 GTGAGCCCCATATTTCTGCCTGG No data
1155605907_1155605913 21 Left 1155605907 18:27605960-27605982 CCAAAAAGTGCCTATCCAGAACC No data
Right 1155605913 18:27606004-27606026 GTGAGCCCCATATTTCTGCCTGG No data
1155605911_1155605913 -4 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605913 18:27606004-27606026 GTGAGCCCCATATTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155605913 Original CRISPR GTGAGCCCCATATTTCTGCC TGG Intergenic