ID: 1155605917

View in Genome Browser
Species Human (GRCh38)
Location 18:27606016-27606038
Sequence TTTCTGCCTGGAGCTCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155605909_1155605917 18 Left 1155605909 18:27605975-27605997 CCAGAACCATCCTTGAATCAATC No data
Right 1155605917 18:27606016-27606038 TTTCTGCCTGGAGCTCACACTGG No data
1155605911_1155605917 8 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605917 18:27606016-27606038 TTTCTGCCTGGAGCTCACACTGG No data
1155605910_1155605917 12 Left 1155605910 18:27605981-27606003 CCATCCTTGAATCAATCTGCCAA No data
Right 1155605917 18:27606016-27606038 TTTCTGCCTGGAGCTCACACTGG No data
1155605912_1155605917 -7 Left 1155605912 18:27606000-27606022 CCAAGTGAGCCCCATATTTCTGC No data
Right 1155605917 18:27606016-27606038 TTTCTGCCTGGAGCTCACACTGG No data
1155605908_1155605917 23 Left 1155605908 18:27605970-27605992 CCTATCCAGAACCATCCTTGAAT No data
Right 1155605917 18:27606016-27606038 TTTCTGCCTGGAGCTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155605917 Original CRISPR TTTCTGCCTGGAGCTCACAC TGG Intergenic