ID: 1155605919

View in Genome Browser
Species Human (GRCh38)
Location 18:27606023-27606045
Sequence CTGGAGCTCACACTGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155605914_1155605919 -9 Left 1155605914 18:27606009-27606031 CCCCATATTTCTGCCTGGAGCTC No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605908_1155605919 30 Left 1155605908 18:27605970-27605992 CCTATCCAGAACCATCCTTGAAT No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605911_1155605919 15 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605915_1155605919 -10 Left 1155605915 18:27606010-27606032 CCCATATTTCTGCCTGGAGCTCA No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605912_1155605919 0 Left 1155605912 18:27606000-27606022 CCAAGTGAGCCCCATATTTCTGC No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605909_1155605919 25 Left 1155605909 18:27605975-27605997 CCAGAACCATCCTTGAATCAATC No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data
1155605910_1155605919 19 Left 1155605910 18:27605981-27606003 CCATCCTTGAATCAATCTGCCAA No data
Right 1155605919 18:27606023-27606045 CTGGAGCTCACACTGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155605919 Original CRISPR CTGGAGCTCACACTGGAAGC AGG Intergenic