ID: 1155605920

View in Genome Browser
Species Human (GRCh38)
Location 18:27606029-27606051
Sequence CTCACACTGGAAGCAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155605914_1155605920 -3 Left 1155605914 18:27606009-27606031 CCCCATATTTCTGCCTGGAGCTC No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data
1155605911_1155605920 21 Left 1155605911 18:27605985-27606007 CCTTGAATCAATCTGCCAAGTGA No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data
1155605912_1155605920 6 Left 1155605912 18:27606000-27606022 CCAAGTGAGCCCCATATTTCTGC No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data
1155605910_1155605920 25 Left 1155605910 18:27605981-27606003 CCATCCTTGAATCAATCTGCCAA No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data
1155605915_1155605920 -4 Left 1155605915 18:27606010-27606032 CCCATATTTCTGCCTGGAGCTCA No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data
1155605916_1155605920 -5 Left 1155605916 18:27606011-27606033 CCATATTTCTGCCTGGAGCTCAC No data
Right 1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155605920 Original CRISPR CTCACACTGGAAGCAGGCAG AGG Intergenic